Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33178
Trapped Gene
Bnipl (ENSMUSG00000028115)
Vector Insertion
Chr 3: 95049571 - 95052723
Public Clones IST10780B3 (tigm) IST10780B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176353 (Chr3:95052498..95052722 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTGGAGGTGGATGAGTTG Chr3:95052553..95052572 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176353 (Chr3:95052498..95052722 -)
Downstram Exon
ENSMUSE00000176361 (Chr3:95049572..95049754 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTGGAGGTGGATGAGTTG Chr3:95052553..95052572 59.96 55 GCTGCTCTCGTTGTCCTGTT Chr3:95049601..95049620 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672372 Chr3:95054887..95055115 TCCTGCCTCCTTAGAGCAAA Chr3:95055027..95055046 60.09 50
upstream ENSMUSE00000718073 Chr3:95054887..95055024 GACCAGGCAAGAAACAGGAA Chr3:95054906..95054925 60.23 50
upstream ENSMUSE00000718629 Chr3:95054887..95055024 GACCAGGCAAGAAACAGGAA Chr3:95054906..95054925 60.23 50
upstream ENSMUSE00000176355 Chr3:95054089..95054184 CCAGGAGCAACCATGAAACT Chr3:95054137..95054156 60.11 50
upstream ENSMUSE00000672370 Chr3:95054089..95054184 CCAGGAGCAACCATGAAACT Chr3:95054137..95054156 60.11 50
upstream ENSMUSE00000176365 Chr3:95053728..95053792 GACCCTCAGAGAGGCTCACA Chr3:95053733..95053752 60.55 60
upstream ENSMUSE00000176353 Chr3:95052498..95052722 ACCTGGAGGTGGATGAGTTG Chr3:95052553..95052572 59.96 55
upstream ENSMUSE00000176361 Chr3:95049572..95049754 TTTCGAACAGGACAACGAGA Chr3:95049628..95049647 59.42 45

*** Putative Vector Insertion (Chr 3: 95049571 - 95052723) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176348 Chr3:95048907..95049009 ATGCTGCTTCGGGGTAGATA Chr3:95048921..95048940 59.69 50
downstream ENSMUSE00000176357 Chr3:95048064..95048195 GCTCCAAAGTTCCCACCATA Chr3:95048151..95048170 59.93 50
downstream ENSMUSE00000176351 Chr3:95046920..95047006 ATACCACGTAGCGTGGACGA Chr3:95046936..95046955 61.51 55
downstream ENSMUSE00000176363 Chr3:95046654..95046752 TGTCCAGAAAGCGGATCTTT Chr3:95046696..95046715 59.81 45
downstream ENSMUSE00000333931 Chr3:95045217..95045783 TGGTTAAGCCTTCCATCCAC Chr3:95045349..95045368 59.93 50
downstream ENSMUSE00000637745 Chr3:95045211..95045783 TGGTTAAGCCTTCCATCCAC Chr3:95045349..95045368 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGAGGCAGCAGAAAGACTG Chr3:95052700..95052721 59.8 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCAGTCTGGCCTTGTGTG Chr3:95049694..95049714 63.07 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028115