Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33179
Trapped Gene
Etohi1 (ENSMUSG00000074519)
Vector Insertion
Chr 2: 177758087 - 177765959
Public Clones (sanger) IST14442C8 (tigm) IST10129G4 (tigm) IST10947A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000722161 (Chr2:177757989..177758086 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGATGTGTTCTGCGTGAC Chr2:177758016..177758035 59.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000722161 (Chr2:177757989..177758086 +)
Downstram Exon
ENSMUSE00000638703 (Chr2:177765960..177766086 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGATGTGTTCTGCGTGAC Chr2:177758016..177758035 59.27 50 TCTGAGAAGCATCCAGCAAA Chr2:177766035..177766054 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678526 Chr2:177757989..177758086 TGTGATGTGTTCTGCGTGAC Chr2:177758016..177758035 59.27 50
upstream ENSMUSE00000722161 Chr2:177757989..177758086 TGTGATGTGTTCTGCGTGAC Chr2:177758016..177758035 59.27 50

*** Putative Vector Insertion (Chr 2: 177758087 - 177765959) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638703 Chr2:177765960..177766086 TCTGAGAAGCATCCAGCAAA Chr2:177766035..177766054 59.67 45
downstream ENSMUSE00000638702 Chr2:177766295..177766355 No primer for this exon
downstream ENSMUSE00000678523 Chr2:177766295..177767120 TCATCAGCTTGCAGAGGAAA Chr2:177766383..177766402 59.67 45
downstream ENSMUSE00000678524 Chr2:177767506..177768727 TCGCTTATGGATTCCGAGAT Chr2:177768022..177768041 59.63 45
downstream ENSMUSE00000678525 Chr2:177769803..177769842 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATGGTAAGTGCCAGGTCA Chr2:177764083..177764103 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTCGTGACTGGGAAAAC Chr2:177764133..177764153 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074519