Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33180
Trapped Gene
Phf16 (ENSMUSG00000037315)
Vector Insertion
Chr X: 20002957 - 20006148
Public Clones IST13763A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656600 (ChrX:20002928..20002956 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656600 (ChrX:20002928..20002956 +)
Downstram Exon
ENSMUSE00000483919 (ChrX:20006149..20006257 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAGCCTTGCTTCTGTTGTC ChrX:20006182..20006201 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656600 ChrX:20002928..20002956 No primer for this exon

*** Putative Vector Insertion (Chr X: 20002957 - 20006148) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000483919 ChrX:20006149..20006257 GGAGCCTTGCTTCTGTTGTC ChrX:20006182..20006201 60 55
downstream ENSMUSE00000484829 ChrX:20012337..20012424 TGGTAGATCTTGGCCACTCC ChrX:20012382..20012401 60.07 55
downstream ENSMUSE00000326534 ChrX:20037642..20037698 TGCTGCTGACAGGTCTATGC ChrX:20037683..20037702 60.17 55
downstream ENSMUSE00000326530 ChrX:20039238..20039317 No primer for this exon
downstream ENSMUSE00000326524 ChrX:20056640..20056797 TTCATGGCACTGATGAGGTC ChrX:20056674..20056693 59.64 50
downstream ENSMUSE00000326519 ChrX:20066828..20067018 GCTTGCTCCAGGGTATTGAT ChrX:20066941..20066960 59.15 50
downstream ENSMUSE00000326510 ChrX:20071283..20071494 No primer for this exon
downstream ENSMUSE00000326505 ChrX:20076552..20076719 TCCCTGTTCTGGTGGTCTTC ChrX:20076681..20076700 60.09 55
downstream ENSMUSE00000326497 ChrX:20079522..20079638 CCCCTGTCTTCAACTTGCAC ChrX:20079630..20079649 60.69 55
downstream ENSMUSE00000326487 ChrX:20088146..20088616 TCTCATCCGAGTGTGAATGC ChrX:20088586..20088605 59.79 50
downstream ENSMUSE00000326478 ChrX:20089862..20089979 TCTGTTCCTGCACTTTGGTG ChrX:20089937..20089956 59.87 50
downstream ENSMUSE00000370428 ChrX:20094112..20097063 GAATGGCTTCGGCTAGTCTG ChrX:20094388..20094407 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGGTTGTGGGCGTAGTTA ChrX:20005990..20006010 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGACGTGTAGCTGATTT ChrX:20005941..20005961 60.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037315