Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33186
Trapped Gene
1810030N24Rik (ENSMUSG00000028295)
Vector Insertion
Chr 4: 34715920 - 34718664
Public Clones IST10494H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177967 (Chr4:34718507..34718663 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177967 (Chr4:34718507..34718663 -)
Downstram Exon
ENSMUSE00000177965 (Chr4:34715921..34716396 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55 AATCCAAAAGCCATCACAGG Chr4:34716349..34716368 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386214 Chr4:34725528..34725598 No primer for this exon
upstream ENSMUSE00000705939 Chr4:34725528..34725672 GAACCGGAAGGAAAGTCCAG Chr4:34725613..34725632 60.99 55
upstream ENSMUSE00000675683 Chr4:34725473..34725519 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675686 Chr4:34725473..34725586 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675690 Chr4:34725473..34725613 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675682 Chr4:34719127..34719302 ACCAGACAAAGGAGCAGCAG Chr4:34719245..34719264 60.59 55
upstream ENSMUSE00000675685 Chr4:34719123..34719302 ACCAGACAAAGGAGCAGCAG Chr4:34719245..34719264 60.59 55
upstream ENSMUSE00000177967 Chr4:34718507..34718663 CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55
upstream ENSMUSE00000711914 Chr4:34718507..34718663 CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55
upstream ENSMUSE00000177965 Chr4:34715921..34716396 ATAGGCTCCGACACCTTTGA Chr4:34716189..34716208 59.69 50

*** Putative Vector Insertion (Chr 4: 34715920 - 34718664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675688 Chr4:34715913..34716396 AATCCAAAAGCCATCACAGG Chr4:34716349..34716368 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACCTGATCCTCCAACAT Chr4:34718612..34718632 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACACGTGACTGGGAAAACC Chr4:34718597..34718617 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028295