Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33189
Trapped Gene
Morc2a (ENSMUSG00000034543)
Vector Insertion
Chr 11: 3550451 - 3558674
Public Clones IST12058G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581525 (Chr11:3550311..3550450 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581525 (Chr11:3550311..3550450 +)
Downstram Exon
ENSMUSE00000581524 (Chr11:3558675..3558728 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50 CAACCAGTTCAGCAAGAGCA Chr11:3558721..3558740 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581526 Chr11:3549497..3550149 AAGCGGTGAAGCCAGAAGTA Chr11:3549868..3549887 60.01 50
upstream ENSMUSE00000682340 Chr11:3550256..3550450 TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50
upstream ENSMUSE00000581525 Chr11:3550311..3550450 TCCTGTTAACCGGCAAAGAC Chr11:3550345..3550364 60.11 50

*** Putative Vector Insertion (Chr 11: 3550451 - 3558674) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581524 Chr11:3558675..3558728 CAACCAGTTCAGCAAGAGCA Chr11:3558721..3558740 60.17 50
downstream ENSMUSE00000581523 Chr11:3561832..3561866 No primer for this exon
downstream ENSMUSE00000581522 Chr11:3568774..3568842 AATCCTCCTCGAAGGTCCTC Chr11:3568804..3568823 59.64 55
downstream ENSMUSE00000312400 Chr11:3569332..3569422 ACTGCCCAATTTGAGTGGAC Chr11:3569406..3569425 59.97 50
downstream ENSMUSE00000656262 Chr11:3572269..3572377 CTCATGAAAGGTGCGAGACA Chr11:3572362..3572381 59.98 50
downstream ENSMUSE00000656261 Chr11:3575831..3575990 GTGATAGGTTCCCGTGTTCG Chr11:3575883..3575902 60.38 55
downstream ENSMUSE00000656260 Chr11:3576107..3576218 TGTCTAGTTCCGGCTCTCCA Chr11:3576169..3576188 60.93 55
downstream ENSMUSE00000623971 Chr11:3576645..3576770 CTCTTGGTCTGCACCTTGTG Chr11:3576746..3576765 59.46 55
downstream ENSMUSE00000656259 Chr11:3577406..3577485 TTCTGCCCGAGTCTTGAAAC Chr11:3577451..3577470 60.38 50
downstream ENSMUSE00000656258 Chr11:3578230..3578312 GTCTCCACCCATGCGTACTT Chr11:3578297..3578316 60 55
downstream ENSMUSE00000656257 Chr11:3578539..3578624 CTACGAAGGGTGATGGCTGT Chr11:3578585..3578604 60.13 55
downstream ENSMUSE00000656279 Chr11:3579659..3579799 CTTGATCAGGCGGCTACAGT Chr11:3579764..3579783 60.42 55
downstream ENSMUSE00000656278 Chr11:3579883..3580037 GATGCCGGTACTCCTTAGCA Chr11:3579986..3580005 60.24 55
downstream ENSMUSE00000656277 Chr11:3580178..3580306 ATGGAGGTTGGTTCCAGTTG Chr11:3580249..3580268 59.82 50
downstream ENSMUSE00000656255 Chr11:3580786..3580891 GTTCATGGAGCAAACCCAAG Chr11:3580874..3580893 60.49 50
downstream ENSMUSE00000656275 Chr11:3581678..3581810 GCTGGCGAATTTTCTCTGTC Chr11:3581787..3581806 59.96 50
downstream ENSMUSE00000656274 Chr11:3583548..3583619 CTTCAGGTCAGCTTGTGAGC Chr11:3583586..3583605 58.75 55
downstream ENSMUSE00000656273 Chr11:3583702..3584079 CTCAGTTGGCTGGAGTAGCC Chr11:3583905..3583924 60.01 60
downstream ENSMUSE00000656272 Chr11:3584617..3584748 AGACTGCAAGACTCCGCTTC Chr11:3584653..3584672 59.75 55
downstream ENSMUSE00000656271 Chr11:3584841..3584895 CCTGAGTTCAGCTGGGTGAT Chr11:3584885..3584904 60.26 55
downstream ENSMUSE00000656270 Chr11:3585388..3585529 GACTCGGCCTGTGTACCACT Chr11:3585446..3585465 60.18 60
downstream ENSMUSE00000656269 Chr11:3585661..3585885 GGAAGACCATCAGAGGTGGA Chr11:3585819..3585838 60.05 55
downstream ENSMUSE00000656268 Chr11:3585979..3586072 AGATGGGGAAACTTGGAGGT Chr11:3586022..3586041 59.79 50
downstream ENSMUSE00000656252 Chr11:3588114..3588302 AATCAGCACGGCTTTGGTAG Chr11:3588186..3588205 60.27 50
downstream ENSMUSE00000339106 Chr11:3589038..3590373 AGCCATCAGATGAAGCTCGT Chr11:3590002..3590021 59.98 50
downstream ENSMUSE00000656265 Chr11:3589038..3590480 AGCCATCAGATGAAGCTCGT Chr11:3590002..3590021 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:3550501..3550521 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAAATGCGTGACTGGGAAAA Chr11:3553495..3553516 59.47 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034543