Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33207
Trapped Gene
Nos2 (ENSMUSG00000020826)
Vector Insertion
Chr 11: 78745231 - 78748853
Public Clones IST13716B12 (tigm) IST13985H9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000266828 (Chr11:78745082..78745230 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000266828 (Chr11:78745082..78745230 +)
Downstram Exon
ENSMUSE00000266822 (Chr11:78748854..78749016 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000282354 Chr11:78734353..78734497 No primer for this exon
upstream ENSMUSE00000406993 Chr11:78735724..78735879 No primer for this exon
upstream ENSMUSE00000349022 Chr11:78742076..78742145 No primer for this exon
upstream ENSMUSE00000266835 Chr11:78743253..78743372 No primer for this exon
upstream ENSMUSE00000266828 Chr11:78745082..78745230 No primer for this exon

*** Putative Vector Insertion (Chr 11: 78745231 - 78748853) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266822 Chr11:78748854..78749016 No primer for this exon
downstream ENSMUSE00000109625 Chr11:78749905..78749996 No primer for this exon
downstream ENSMUSE00000578211 Chr11:78751063..78751204 No primer for this exon
downstream ENSMUSE00000393381 Chr11:78751302..78751441 No primer for this exon
downstream ENSMUSE00000578210 Chr11:78753481..78753655 No primer for this exon
downstream ENSMUSE00000109733 Chr11:78753750..78753851 No primer for this exon
downstream ENSMUSE00000109710 Chr11:78758162..78758356 No primer for this exon
downstream ENSMUSE00000109722 Chr11:78758734..78758816 No primer for this exon
downstream ENSMUSE00000109730 Chr11:78759141..78759285 No primer for this exon
downstream ENSMUSE00000109713 Chr11:78759371..78759475 No primer for this exon
downstream ENSMUSE00000109706 Chr11:78761349..78761398 No primer for this exon
downstream ENSMUSE00000109726 Chr11:78761715..78761889 No primer for this exon
downstream ENSMUSE00000109725 Chr11:78762585..78762717 No primer for this exon
downstream ENSMUSE00000109721 Chr11:78763116..78763194 No primer for this exon
downstream ENSMUSE00000109720 Chr11:78763458..78763639 No primer for this exon
downstream ENSMUSE00000282250 Chr11:78764597..78764760 No primer for this exon
downstream ENSMUSE00000109732 Chr11:78766305..78766512 No primer for this exon
downstream ENSMUSE00000282222 Chr11:78768397..78768484 No primer for this exon
downstream ENSMUSE00000282211 Chr11:78768842..78768963 No primer for this exon
downstream ENSMUSE00000282199 Chr11:78769998..78770146 No primer for this exon
downstream ENSMUSE00000109727 Chr11:78770912..78771106 No primer for this exon
downstream ENSMUSE00000364563 Chr11:78773156..78773727 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTACTCCCTGGGTAATCG Chr11:78745268..78745288 60.69 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTCGTCAGGGTGACATC Chr11:78745241..78745261 60.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020826