Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33211
Trapped Gene
Ikzf5 (ENSMUSG00000040167)
Vector Insertion
Chr 7: 138532163 - 138537452
Public Clones IST10124B10 (tigm) IST10124A9 (tigm) IST10124A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343074 (Chr7:138537269..138537451 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACATCAGGATCCACACAG Chr7:138537269..138537288 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343074 (Chr7:138537269..138537451 -)
Downstram Exon
ENSMUSE00000397988 (Chr7:138532164..138536094 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACATCAGGATCCACACAG Chr7:138537269..138537288 60.12 55 CAAGACTTGCACCTCGCATA Chr7:138532280..138532299 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487303 Chr7:138553901..138553992 No primer for this exon
upstream ENSMUSE00000715619 Chr7:138553901..138554011 CAACAAATATGGCGGCTACA Chr7:138553991..138554010 59.58 45
upstream ENSMUSE00000489259 Chr7:138540183..138540365 AGCAGACGCATCATGTGAAC Chr7:138540235..138540254 59.87 50
upstream ENSMUSE00000719077 Chr7:138540183..138540365 AGCAGACGCATCATGTGAAC Chr7:138540235..138540254 59.87 50
upstream ENSMUSE00000343074 Chr7:138537269..138537451 GCACATCAGGATCCACACAG Chr7:138537269..138537288 60.12 55
upstream ENSMUSE00000714442 Chr7:138533882..138535635 AGTGCCCACACCAGTACTCC Chr7:138535389..138535408 60.03 60
upstream ENSMUSE00000397988 Chr7:138532164..138536094 AGTGCCCACACCAGTACTCC Chr7:138535389..138535408 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC Chr7:138534384..138534404 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTGCACGATTTCTTTTGC Chr7:138537462..138537482 60.53 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040167