Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33218
Trapped Gene
Oscar (ENSMUSG00000054594)
Vector Insertion
Chr 7: 3563185 - 3567119
Public Clones IST13383A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601615 (Chr7:3567086..3567118 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGCTGACTTCACACCAAC Chr7:3567088..3567107 60.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601615 (Chr7:3567086..3567118 -)
Downstram Exon
ENSMUSE00000308924 (Chr7:3563186..3563485 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGCTGACTTCACACCAAC Chr7:3567088..3567107 60.36 55 CAGTGATAACTGCCCCCTTG Chr7:3563238..3563257 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677455 Chr7:3567643..3567759 GGTCCTGTCGCTGATACTCC Chr7:3567658..3567677 59.69 60
upstream ENSMUSE00000601616 Chr7:3567625..3567735 CCAGCTGTCGACTCTCTGTG Chr7:3567640..3567659 59.76 60
upstream ENSMUSE00000601615 Chr7:3567086..3567118 CGTGCTGACTTCACACCAAC Chr7:3567088..3567107 60.36 55
upstream ENSMUSE00000308924 Chr7:3563186..3563485 ACTCCTGGGATCAACGTGAC Chr7:3563410..3563429 59.97 55

*** Putative Vector Insertion (Chr 7: 3563185 - 3567119) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308915 Chr7:3562671..3562952 CTACGCGGTACAGTGCAAAA Chr7:3562811..3562830 59.93 50
downstream ENSMUSE00000161971 Chr7:3561419..3562511 CCAAGCAGATGAGGACCATT Chr7:3562415..3562434 60.07 50
downstream ENSMUSE00000377699 Chr7:3561415..3562511 CCAAGCAGATGAGGACCATT Chr7:3562415..3562434 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTCCTAATCGCCTTGCAG Chr7:3564054..3564074 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTAAACGTGACTGGGAAAAC Chr7:3564053..3564075 59.78 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054594