Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33229
Trapped Gene
AC131691.4 (ENSMUSG00000074911)
Vector Insertion
Chr 16: 91689526 - 91709022
Public Clones IST12322D12 (tigm) IST12322D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697827 (Chr16:91689143..91689525 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCGGAAAAGGGATTAAC Chr16:91689226..91689245 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697827 (Chr16:91689143..91689525 +)
Downstram Exon
ENSMUSE00000697826 (Chr16:91709023..91709135 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCGGAAAAGGGATTAAC Chr16:91689226..91689245 59.91 50 ACGAAGTGGTCGGTAAGTGG Chr16:91709088..91709107 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697827 Chr16:91689143..91689525 GGCTCGGAAAAGGGATTAAC Chr16:91689226..91689245 59.91 50

*** Putative Vector Insertion (Chr 16: 91689526 - 91709022) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697826 Chr16:91709023..91709135 ACGAAGTGGTCGGTAAGTGG Chr16:91709088..91709107 60.03 55
downstream ENSMUSE00000697825 Chr16:91710080..91710143 TGAGGCCATTTTACTTCGTTTT Chr16:91710115..91710136 60 36.36
downstream ENSMUSE00000697823 Chr16:91710395..91710505 AGGATTCCGTCTGAGAGCTG Chr16:91710429..91710448 59.56 55
downstream ENSMUSE00000697821 Chr16:91711993..91712198 TTTGTTTCGGATGGTTGTGA Chr16:91712100..91712119 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTGTCCTAATCGCCTTGC Chr16:91692569..91692589 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTTGGGGAGGCAATATC Chr16:91692487..91692507 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074911