Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33232
Trapped Gene
Emilin2 (ENSMUSG00000024053)
Vector Insertion
Chr 17: 71605663 - 71624628
Public Clones IST11824C4 (tigm) IST11078F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235458 (Chr17:71622714..71624627 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAATCGCACTCCAGAGACA Chr17:71622810..71622829 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235458 (Chr17:71622714..71624627 -)
Downstram Exon
ENSMUSE00000400126 (Chr17:71605664..71606032 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAATCGCACTCCAGAGACA Chr17:71622810..71622829 59.98 50 TCCATGATGACGCCACTAGA Chr17:71605764..71605783 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394943 Chr17:71660058..71660326 TTGTGGGGCTCAAGATGTGT Chr17:71660195..71660214 61.53 50
upstream ENSMUSE00000235492 Chr17:71659489..71659611 TGCGCCTACATCGTGAATAA Chr17:71659585..71659604 60.24 45
upstream ENSMUSE00000235473 Chr17:71630014..71630189 AGAGGACCAGACTGCCAAGA Chr17:71630088..71630107 59.99 55
upstream ENSMUSE00000235458 Chr17:71622714..71624627 CAAATCGCACTCCAGAGACA Chr17:71622810..71622829 59.98 50
upstream ENSMUSE00000400126 Chr17:71605664..71606032 CATAGCTCGGAAGGCTATGC Chr17:71605675..71605694 59.97 55

*** Putative Vector Insertion (Chr 17: 71605663 - 71624628) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137666 Chr17:71605320..71605352 AGGAGGTGACTTGGGGTAGC Chr17:71605311..71605330 60.51 60
downstream ENSMUSE00000137670 Chr17:71604459..71604587 ATACATCCCCATCGTTCACC Chr17:71604452..71604471 59.49 50
downstream ENSMUSE00000390252 Chr17:71601516..71602433 GAGACAGACAGGACGGCTTC Chr17:71602318..71602337 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACACCTAATCGCCTTGCAG Chr17:71618563..71618583 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCAGAATCTGGTTGTGC Chr17:71615617..71615637 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024053