Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33246
Trapped Gene
Slc4a4 (ENSMUSG00000060961)
Vector Insertion
Chr 5: 89626788 - 89628679
Public Clones IST12444H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222161 (Chr5:89626674..89626787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGACACTCCGAAGCTCAT Chr5:89626749..89626768 60.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222161 (Chr5:89626674..89626787 +)
Downstram Exon
ENSMUSE00000222154 (Chr5:89628680..89628841 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGACACTCCGAAGCTCAT Chr5:89626749..89626768 60.27 55 GGACAAACCAACCCCTGTTA Chr5:89628713..89628732 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694812 Chr5:89316322..89316349 No primer for this exon
upstream ENSMUSE00000486552 Chr5:89363774..89363847 GGGGCTTCCTTCCTTAAACA Chr5:89363802..89363821 60.42 50
upstream ENSMUSE00000222258 Chr5:89383803..89383982 ACGATCTACATTGGGGTCCA Chr5:89383811..89383830 60.19 50
upstream ENSMUSE00000423258 Chr5:89457102..89457453 GAACGCATCCGATTCATCTT Chr5:89457332..89457351 60.04 45
upstream ENSMUSE00000513687 Chr5:89457318..89457453 GAACGCATCCGATTCATCTT Chr5:89457332..89457351 60.04 45
upstream ENSMUSE00000510764 Chr5:89467476..89467636 ACAGCCTGTTTGAGCTGAGG Chr5:89467553..89467572 60.59 55
upstream ENSMUSE00000694806 Chr5:89469383..89471385 CACACACACACACACCCTGA Chr5:89471156..89471175 60.09 55
upstream ENSMUSE00000515446 Chr5:89475238..89475417 CCAGATCGAGACAGGCCTAC Chr5:89475254..89475273 59.83 60
upstream ENSMUSE00000512636 Chr5:89513667..89513743 CCCACAGGAATCTGACATCC Chr5:89513682..89513701 60.33 55
upstream ENSMUSE00000517188 Chr5:89551427..89551584 CATTGCCTTTGTTCGCCTAC Chr5:89551516..89551535 60.64 50
upstream ENSMUSE00000188238 Chr5:89558664..89558751 AAGAGCTATCGCCACCTTGA Chr5:89558721..89558740 59.98 50
upstream ENSMUSE00000188244 Chr5:89561396..89561550 GACCCCACAATCCGAATAGA Chr5:89561498..89561517 59.75 50
upstream ENSMUSE00000188249 Chr5:89562182..89562295 GATGAATGGGGACACACCTC Chr5:89562215..89562234 60.18 55
upstream ENSMUSE00000188241 Chr5:89564671..89564845 ATCTGGCAACCGTAACCAAC Chr5:89564778..89564797 59.86 50
upstream ENSMUSE00000188239 Chr5:89578325..89578458 GGACCAGTGTTGGTGTTTGA Chr5:89578415..89578434 59.42 50
upstream ENSMUSE00000188245 Chr5:89585356..89585627 TCACCCGTTTCACAGAAGAA Chr5:89585463..89585482 59.26 45
upstream ENSMUSE00000188255 Chr5:89599776..89599846 CCTGCCGACCATTTCTTCTA Chr5:89599819..89599838 60.21 50
upstream ENSMUSE00000188259 Chr5:89608678..89608869 TCTTCCTGGGCACTTACACC Chr5:89608799..89608818 60.11 55
upstream ENSMUSE00000222161 Chr5:89626674..89626787 GTGGACACTCCGAAGCTCAT Chr5:89626749..89626768 60.27 55

*** Putative Vector Insertion (Chr 5: 89626788 - 89628679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222154 Chr5:89628680..89628841 GGACAAACCAACCCCTGTTA Chr5:89628713..89628732 59.69 50
downstream ENSMUSE00000188236 Chr5:89643499..89643677 GACTGTCAATGTGGGCAATG Chr5:89643622..89643641 59.97 50
downstream ENSMUSE00000188257 Chr5:89644746..89644818 GGGTTCCAGTGACTCGTTGT Chr5:89644771..89644790 60.01 55
downstream ENSMUSE00000496324 Chr5:89652221..89652289 CTGCACACCGTTAAGTGAGG Chr5:89652292..89652311 59.36 55
downstream ENSMUSE00000497078 Chr5:89654825..89654998 GGTAGATGAAGTCGGGCTGA Chr5:89654888..89654907 60.22 55
downstream ENSMUSE00000498161 Chr5:89657851..89658012 TCGTCATTGTCGCTATCCAA Chr5:89658014..89658033 60.22 45
downstream ENSMUSE00000498979 Chr5:89661789..89661885 AGGTTGCTGTTCCATGATGTC Chr5:89661859..89661879 59.99 47.62
downstream ENSMUSE00000499989 Chr5:89663822..89663901 GGTAAACCCAGCGACTCAAG Chr5:89663901..89663920 59.73 55
downstream ENSMUSE00000694811 Chr5:89663822..89663892 CGTTCGAGGAATGTTGAGGA Chr5:89663852..89663871 61.18 50
downstream ENSMUSE00000694814 Chr5:89664532..89664563 AGGCACGACTTTCACTGGAG Chr5:89664565..89664584 60.44 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGACACTCCGAAGCTCAT Chr5:89626750..89626770 60.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGACACTCCGAAGCTCAT Chr5:89626750..89626770 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060961