Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33247
Trapped Gene
Xkr5 (ENSMUSG00000039814)
Vector Insertion
Chr 8: 18950535 - 18950976
Public Clones IST14193B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609812 (Chr8:18950876..18950975 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAGCTCAGAAGATGCAC Chr8:18950928..18950947 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609812 (Chr8:18950876..18950975 -)
Downstram Exon
ENSMUSE00000422628 (Chr8:18950536..18950959 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAGCTCAGAAGATGCAC Chr8:18950928..18950947 59.89 55 AGGCTAGGACGGGAGATCAT Chr8:18950694..18950713 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000609812 Chr8:18950876..18950975 CAGCAGCTCAGAAGATGCAC Chr8:18950928..18950947 59.89 55
upstream ENSMUSE00000422628 Chr8:18950536..18950959 ATGGATCCTCCCCATACTCC Chr8:18950626..18950645 59.98 55

*** Putative Vector Insertion (Chr 8: 18950535 - 18950976) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000422601 Chr8:18948559..18948742 GACCCGTGGCAAAGTAGAAA Chr8:18948685..18948704 60.11 50
downstream ENSMUSE00000609811 Chr8:18948559..18948742 GACCCGTGGCAAAGTAGAAA Chr8:18948685..18948704 60.11 50
downstream ENSMUSE00000225953 Chr8:18941945..18942129 GGAACACGTAAGCCTGAAGC Chr8:18941953..18941972 59.88 55
downstream ENSMUSE00000609810 Chr8:18941945..18942129 GGAACACGTAAGCCTGAAGC Chr8:18941953..18941972 59.88 55
downstream ENSMUSE00000340353 Chr8:18940613..18940822 CCAGGAGAGTAGGGCACTGA Chr8:18940778..18940797 60.4 60
downstream ENSMUSE00000609809 Chr8:18940613..18940822 CCAGGAGAGTAGGGCACTGA Chr8:18940778..18940797 60.4 60
downstream ENSMUSE00000685339 Chr8:18939068..18939237 CGAGCCAGAAGGTCATCACT Chr8:18939183..18939202 60.41 55
downstream ENSMUSE00000402623 Chr8:18937227..18937338 ATGGAGTTCTCCAGCAGCAT Chr8:18937294..18937313 59.83 50
downstream ENSMUSE00000359262 Chr8:18932730..18934605 GGGCTTAGTGACTGCCTGAG Chr8:18933739..18933758 60.01 60
downstream ENSMUSE00000609807 Chr8:18932729..18934605 GGGCTTAGTGACTGCCTGAG Chr8:18933739..18933758 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCAGCTCAGAAGATGCAC Chr8:18950926..18950946 59.89 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCAGCTCAGAAGATGCAC Chr8:18950926..18950946 59.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039814