Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33248
Trapped Gene
Pias3 (ENSMUSG00000028101)
Vector Insertion
Chr 3: 96508310 - 96508771
Public Clones IST14812C2 (tigm) IST14812C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176095 (Chr3:96508272..96508309 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176095 (Chr3:96508272..96508309 +)
Downstram Exon
ENSMUSE00000439152 (Chr3:96508772..96509839 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCCTGTTAGGCAGCGATAAG Chr3:96509204..96509223 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672029 Chr3:96500307..96500454 No primer for this exon
upstream ENSMUSE00000714246 Chr3:96501040..96501118 No primer for this exon
upstream ENSMUSE00000716198 Chr3:96501040..96501118 No primer for this exon
upstream ENSMUSE00000471133 Chr3:96503343..96503760 CAGCGTCCAGATGAAGATCA Chr3:96503471..96503490 59.94 50
upstream ENSMUSE00000483592 Chr3:96503343..96503576 CAGCGTCCAGATGAAGATCA Chr3:96503471..96503490 59.94 50
upstream ENSMUSE00000672028 Chr3:96503343..96503760 CAGCGTCCAGATGAAGATCA Chr3:96503471..96503490 59.94 50
upstream ENSMUSE00000672030 Chr3:96503343..96503576 CAGCGTCCAGATGAAGATCA Chr3:96503471..96503490 59.94 50
upstream ENSMUSE00000486133 Chr3:96503682..96503760 ATGTCACCATGAAGCCACTG Chr3:96503695..96503714 59.55 50
upstream ENSMUSE00000176100 Chr3:96503916..96504000 CAGCTGCAGCAGATTCTCAC Chr3:96503975..96503994 59.89 55
upstream ENSMUSE00000176107 Chr3:96504141..96504191 No primer for this exon
upstream ENSMUSE00000176104 Chr3:96504412..96504502 TGCCCTCAGGAGGACTATTT Chr3:96504434..96504453 58.74 50
upstream ENSMUSE00000176103 Chr3:96505209..96505343 CGATCAACATCACACCCTTG Chr3:96505261..96505280 59.96 50
upstream ENSMUSE00000176098 Chr3:96505539..96505644 TTGTCCGTGTACCTGGTGAG Chr3:96505548..96505567 59.59 55
upstream ENSMUSE00000176106 Chr3:96506097..96506170 ACAAGTCTCCGGGTGTCACT Chr3:96506141..96506160 59.6 55
upstream ENSMUSE00000566047 Chr3:96506280..96506440 GAGAAGAAGCCGACATGGAC Chr3:96506370..96506389 59.81 55
upstream ENSMUSE00000176096 Chr3:96507449..96507582 TCCTGTTCGGATTGTGATGA Chr3:96507471..96507490 60.05 45
upstream ENSMUSE00000176102 Chr3:96507662..96507830 TGACCATCGAAAGCTCATCA Chr3:96507731..96507750 60.35 45
upstream ENSMUSE00000176108 Chr3:96507982..96508115 ATGAGTACCCACCTGCCTTC Chr3:96508074..96508093 59.02 55
upstream ENSMUSE00000176095 Chr3:96508272..96508309 No primer for this exon

*** Putative Vector Insertion (Chr 3: 96508310 - 96508771) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000439152 Chr3:96508772..96509839 GCCTGTTAGGCAGCGATAAG Chr3:96509204..96509223 60 55
downstream ENSMUSE00000705670 Chr3:96508772..96509885 GCCTGTTAGGCAGCGATAAG Chr3:96509204..96509223 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr3:96508359..96508379 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGAAGAGTCCATTCTACGTG Chr3:96508344..96508365 59.74 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028101