Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33252
Trapped Gene
Fbxo44 (ENSMUSG00000029001)
Vector Insertion
Chr 4: 147528530 - 147530391
Public Clones IST12980D9 (tigm) IST12441H6 (tigm) IST12998E12 (tigm) IST13678E8 (tigm)
IST11998H3 (tigm) IST13897H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336662 (Chr4:147530255..147530390 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCAGCAGAAAAGCGATGC Chr4:147530268..147530287 60.5 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336662 (Chr4:147530255..147530390 -)
Downstram Exon
ENSMUSE00000667221 (Chr4:147528531..147528542 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCAGCAGAAAAGCGATGC Chr4:147530268..147530287 60.5 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399077 Chr4:147533852..147533989 ACAGAAGGAGGGGAGCAGTG Chr4:147533969..147533988 61.77 60
upstream ENSMUSE00000371999 Chr4:147532646..147532932 TAGGCAACATCAACGAGCTG Chr4:147532884..147532903 60.01 50
upstream ENSMUSE00000667224 Chr4:147530718..147530815 GAGGCGATGAATGGAAGGTA Chr4:147530763..147530782 60.04 50
upstream ENSMUSE00000342201 Chr4:147530689..147530815 GAGGCGATGAATGGAAGGTA Chr4:147530763..147530782 60.04 50
upstream ENSMUSE00000385299 Chr4:147530504..147530599 TCAAGGCTGAAGGGTATTGG Chr4:147530551..147530570 60.07 50
upstream ENSMUSE00000336662 Chr4:147530255..147530390 ATTCAGCAGAAAAGCGATGC Chr4:147530268..147530287 60.5 45
upstream ENSMUSE00000667223 Chr4:147530255..147530390 ATTCAGCAGAAAAGCGATGC Chr4:147530268..147530287 60.5 45
upstream ENSMUSE00000667221 Chr4:147528531..147528542 No primer for this exon

*** Putative Vector Insertion (Chr 4: 147528530 - 147530391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393062 Chr4:147526910..147527753 AAACCCTGGTCCATCCTACC Chr4:147527033..147527052 60.05 55
downstream ENSMUSE00000667222 Chr4:147526910..147527753 AAACCCTGGTCCATCCTACC Chr4:147527033..147527052 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCTATCTCCCAGGTCTTC Chr4:147530418..147530438 59.89 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCTATCTCCCAGGTCTTC Chr4:147530418..147530438 59.89 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029001