Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3327
Trapped Gene
Ell (ENSMUSG00000070002)
Vector Insertion
Chr 8: 73063741 - 73096761
Public Clones AM0479 (sanger) AC0478 (sanger) AF0602 (sanger) AF0601 (sanger)
AS0166 (sanger) XR0863 (sanger) AL0041 (sanger) AC0486 (sanger)
AW0369 (sanger) AS0990 (sanger) RRO231 (baygenomics) RRO327 (baygenomics)
RRJ538 (baygenomics) RRO232 (baygenomics) RRS092 (baygenomics) XL961 (baygenomics)
RRO223 (baygenomics) RRO240 (baygenomics) RRS297 (baygenomics) IST15072H4 (tigm)
IST11570F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581995 (Chr8:73063604..73063740 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCACCGACAGTGCTTTGAA Chr8:73063693..73063712 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581995 (Chr8:73063604..73063740 +)
Downstram Exon
ENSMUSE00000581994 (Chr8:73096762..73096809 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCACCGACAGTGCTTTGAA Chr8:73063693..73063712 60.03 50 TCAAATCGGATGGAAGGTCT Chr8:73096799..73096818 59.48 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581995 Chr8:73063604..73063740 CTCACCGACAGTGCTTTGAA Chr8:73063693..73063712 60.03 50

*** Putative Vector Insertion (Chr 8: 73063741 - 73096761) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581994 Chr8:73096762..73096809 TCAAATCGGATGGAAGGTCT Chr8:73096799..73096818 59.48 45
downstream ENSMUSE00000581993 Chr8:73102736..73102857 GTTGGATGCAATCAAAGCTG Chr8:73102847..73102866 59.28 45
downstream ENSMUSE00000581992 Chr8:73102992..73103155 CAGTAGCACACACCGTGACC Chr8:73103059..73103078 60.23 60
downstream ENSMUSE00000581991 Chr8:73105454..73105719 AGGGCCTCTGTACCACACTG Chr8:73105597..73105616 60.17 60
downstream ENSMUSE00000581990 Chr8:73107771..73107895 GCAGGCTTTTGTACATGCAG Chr8:73107837..73107856 59.49 50
downstream ENSMUSE00000581989 Chr8:73109056..73109134 No primer for this exon
downstream ENSMUSE00000581988 Chr8:73109453..73109927 GTGCTCGCTGTGTGAAATGT Chr8:73109528..73109547 59.91 50
downstream ENSMUSE00000581987 Chr8:73114419..73114479 GTTCATTGTCACAGGCTCCA Chr8:73114448..73114467 59.68 50
downstream ENSMUSE00000581986 Chr8:73114593..73114764 TTGTAGCTCTGACGCTGCTC Chr8:73114640..73114659 59.49 55
downstream ENSMUSE00000581985 Chr8:73115269..73115313 No primer for this exon
downstream ENSMUSE00000581983 Chr8:73115397..73116755 CCTCTAGGGTCTGGGGACTC Chr8:73116276..73116295 60.07 65

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGATAGGGCACACTGTCAT Chr8:73081746..73081766 59.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGATAGGGCACACTGTCAT Chr8:73081746..73081766 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070002