Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33272
Trapped Gene
Pdgfb (ENSMUSG00000000489)
Vector Insertion
Chr 15: 79835898 - 79845239
Public Clones IST14912G9 (tigm) IST14361C6 (tigm) IST13729C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259080 (Chr15:79844366..79845238 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259080 (Chr15:79844366..79845238 -)
Downstram Exon
ENSMUSE00000126332 (Chr15:79835899..79835995 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000259080 Chr15:79844366..79845238 No primer for this exon
upstream ENSMUSE00000126332 Chr15:79835899..79835995 No primer for this exon

*** Putative Vector Insertion (Chr 15: 79835898 - 79845239) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000126334 Chr15:79833755..79833844 No primer for this exon
downstream ENSMUSE00000126330 Chr15:79832112..79832317 No primer for this exon
downstream ENSMUSE00000126335 Chr15:79830759..79830903 No primer for this exon
downstream ENSMUSE00000259046 Chr15:79827986..79828134 No primer for this exon
downstream ENSMUSE00000467414 Chr15:79826330..79827687 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCACTGCTGGATATGTA Chr15:79836226..79836246 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCACTGCTGGATATGTA Chr15:79836226..79836246 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000489