Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33280
Trapped Gene
Lix1 (ENSMUSG00000047786)
Vector Insertion
Chr 17: 17583028 - 17585999
Public Clones (sanger) IST14302B3 (tigm) IST11826C2 (tigm) IST11826C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346882 (Chr17:17582932..17583027 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGTTAGATGATGCGGATG Chr17:17582934..17582953 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346882 (Chr17:17582932..17583027 +)
Downstram Exon
ENSMUSE00000658211 (Chr17:17586000..17586101 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGTTAGATGATGCGGATG Chr17:17582934..17582953 60.1 50 AGGACTGGCCCACAGAAAAT Chr17:17586032..17586051 60.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358111 Chr17:17539650..17539990 ACTGCATCAATGAGCTGCAC Chr17:17539817..17539836 60.02 50
upstream ENSMUSE00000255754 Chr17:17564120..17564283 GAGCTGCTTTGGCAACTTTC Chr17:17564262..17564281 60.14 50
upstream ENSMUSE00000391086 Chr17:17580612..17580752 GAAGCAGTAGCCTCCACCAG Chr17:17580732..17580751 60.01 60
upstream ENSMUSE00000346882 Chr17:17582932..17583027 CACGTTAGATGATGCGGATG Chr17:17582934..17582953 60.1 50

*** Putative Vector Insertion (Chr 17: 17583028 - 17585999) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658211 Chr17:17586000..17586101 AGGACTGGCCCACAGAAAAT Chr17:17586032..17586051 60.88 50
downstream ENSMUSE00000555243 Chr17:17591224..17591301 CGAGAGCACTTTGTTTCACG Chr17:17591300..17591319 59.63 50
downstream ENSMUSE00000658210 Chr17:17594070..17596349 GTGGACATTGCCAAACACAG Chr17:17595395..17595414 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTGCCACTTATTTGTTTG Chr17:17583039..17583059 59.37 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTGCCACTTATTTGTTTG Chr17:17583039..17583059 59.37 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047786