Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33281
Trapped Gene
Cspg5 (ENSMUSG00000032482)
Vector Insertion
Chr 9: 110149895 - 110153462
Public Clones CMHD-GT_537D8-3 (cmhd) CMHD-GT_537D8-5S (cmhd) IST12094D6 (tigm) IST11406H3 (tigm)
IST12094D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362304 (Chr9:110148799..110149894 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCTGATACCGAAGGAGA Chr9:110149416..110149435 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362304 (Chr9:110148799..110149894 +)
Downstram Exon
ENSMUSE00000220020 (Chr9:110153463..110153651 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCTGATACCGAAGGAGA Chr9:110149416..110149435 60.06 55 CTCCGCAGCTTGGTATTCTC Chr9:110153648..110153667 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583196 Chr9:110146287..110148198 GACCTCTCTCTCCACGTTGC Chr9:110147162..110147181 59.99 60
upstream ENSMUSE00000362304 Chr9:110148799..110149894 CACCCTGATACCGAAGGAGA Chr9:110149416..110149435 60.06 55

*** Putative Vector Insertion (Chr 9: 110149895 - 110153462) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220020 Chr9:110153463..110153651 CTCCGCAGCTTGGTATTCTC Chr9:110153648..110153667 59.98 55
downstream ENSMUSE00000220019 Chr9:110158649..110158805 GTTGTCGTTGTGGAGCTCAG Chr9:110158688..110158707 59.47 55
downstream ENSMUSE00000310179 Chr9:110164564..110165079 CAGACAGTTCACCCCCAAGT Chr9:110164710..110164729 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGTTGGAGCCTGGGAAT Chr9:110149859..110149879 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGGAGCCTGGGAATGTC Chr9:110149862..110149882 61.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032482