Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33290
Trapped Gene
Klhl1 (ENSMUSG00000022076)
Vector Insertion
Chr 14: 96745988 - 96767894
Public Clones IST10218D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273024 (Chr14:96767757..96767893 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAATGCACTCTGGGATCT Chr14:96767777..96767796 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273024 (Chr14:96767757..96767893 -)
Downstram Exon
ENSMUSE00000273017 (Chr14:96745989..96746185 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAATGCACTCTGGGATCT Chr14:96767777..96767796 60.07 50 GCATCAGCAAATGCCCTTAT Chr14:96746013..96746032 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388647 Chr14:96917031..96918253 ACTCCGCTGGAAACTCTTCA Chr14:96917470..96917489 59.99 50
upstream ENSMUSE00000273031 Chr14:96780990..96781172 TTGACATCGACCAATCATTCA Chr14:96781151..96781171 59.92 38.1
upstream ENSMUSE00000273024 Chr14:96767757..96767893 CCAAATGCACTCTGGGATCT Chr14:96767777..96767796 60.07 50
upstream ENSMUSE00000273017 Chr14:96745989..96746185 CATTTGCTGATGCTCAAGGA Chr14:96746028..96746047 59.95 45

*** Putative Vector Insertion (Chr 14: 96745988 - 96767894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273009 Chr14:96679222..96679434 TGTGGTGGAAGCAGTGGTAA Chr14:96679201..96679220 60.15 50
downstream ENSMUSE00000272998 Chr14:96639427..96639613 CCCCCACTGCATAAAGAGTT Chr14:96639423..96639442 59.05 50
downstream ENSMUSE00000123414 Chr14:96600432..96600656 CCACAGATTTGTTCGGAGGT Chr14:96600591..96600610 59.97 50
downstream ENSMUSE00000123415 Chr14:96551125..96551287 TCCGAGCAATGGACATACTG Chr14:96551134..96551153 59.67 50
downstream ENSMUSE00000123417 Chr14:96535804..96536016 GTGGTTTGAAGCAGGAGCAT Chr14:96535811..96535830 60.26 50
downstream ENSMUSE00000272970 Chr14:96522436..96522607 AGGACTCCATGGTGTTGAGG Chr14:96522443..96522462 59.96 55
downstream ENSMUSE00000371734 Chr14:96504485..96505618 TTTTGATAAACCCGCCTTTG Chr14:96505243..96505262 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:96746824..96746844 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCGTATGCTTACTGCCAAC Chr14:96746894..96746915 59.44 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022076