Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33297
Trapped Gene
Zfp708 (ENSMUSG00000058883)
Vector Insertion
Chr 13: 67182385 - 67198771
Public Clones IST13191H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681391 (Chr13:67198729..67198770 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCAACGCCAAAGAAATG Chr13:67198735..67198754 59.66 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681391 (Chr13:67198729..67198770 -)
Downstram Exon
ENSMUSE00000681390 (Chr13:67182386..67182448 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCAACGCCAAAGAAATG Chr13:67198735..67198754 59.66 40 AACTTTGAGAAAGCCGCAGA Chr13:67182401..67182420 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681391 Chr13:67198729..67198770 TCATCAACGCCAAAGAAATG Chr13:67198735..67198754 59.66 40
upstream ENSMUSE00000681390 Chr13:67182386..67182448 TCTGCGGCTTTCTCAAAGTT Chr13:67182423..67182442 60.13 45

*** Putative Vector Insertion (Chr 13: 67182385 - 67198771) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681395 Chr13:67176534..67176559 No primer for this exon
downstream ENSMUSE00000681394 Chr13:67176299..67176299 No primer for this exon
downstream ENSMUSE00000681393 Chr13:67176060..67176074 No primer for this exon
downstream ENSMUSE00000491218 Chr13:67175769..67175895 CAGAGAAATCAATGGCCACA Chr13:67175834..67175853 59.65 45
downstream ENSMUSE00000507485 Chr13:67175022..67175117 CTGCTCCAGAAATGTGACCA Chr13:67175052..67175071 59.83 50
downstream ENSMUSE00000641359 Chr13:67171134..67172464 TTGAAGGTCTTGTCGCAGTG Chr13:67171308..67171327 60.03 50
downstream ENSMUSE00000520932 Chr13:67171091..67171129 No primer for this exon
downstream ENSMUSE00000520082 Chr13:67170336..67172464 TTGAAGGTCTTGTCGCAGTG Chr13:67171308..67171327 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGCCAAAGAAATGACCAA Chr13:67198728..67198748 60.48 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGCCAAAGAAATGACCAA Chr13:67198728..67198748 60.48 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058883