Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33308
Trapped Gene
Cpne5 (ENSMUSG00000024008)
Vector Insertion
Chr 17: 29325237 - 29339514
Public Clones IST13971C9 (tigm) IST10989G11 (tigm) IST13945H9 (tigm) IST10989G11 (tigm)
IST13945H9 (tigm) IST14913E6 (tigm) IST14587F2 (tigm) IST13977D3 (tigm)
IST13971C9 (tigm) IST13977D3 (tigm) IST12668G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000549077 (Chr17:29339450..29339513 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000549077 (Chr17:29339450..29339513 -)
Downstram Exon
ENSMUSE00000549076 (Chr17:29325238..29325341 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50 TTATCCAGCTTGTTGGCACA Chr17:29325279..29325298 60.26 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718983 Chr17:29374558..29374742 AATCGCGCAGGAATATTGAC Chr17:29374684..29374703 60.07 45
upstream ENSMUSE00000721728 Chr17:29374558..29374742 AATCGCGCAGGAATATTGAC Chr17:29374684..29374703 60.07 45
upstream ENSMUSE00000549087 Chr17:29363138..29363178 No primer for this exon
upstream ENSMUSE00000609784 Chr17:29363138..29363178 No primer for this exon
upstream ENSMUSE00000549084 Chr17:29362136..29362182 AAGGGATGGAGAACAAGCAA Chr17:29362145..29362164 59.67 45
upstream ENSMUSE00000609783 Chr17:29362136..29362182 AAGGGATGGAGAACAAGCAA Chr17:29362145..29362164 59.67 45
upstream ENSMUSE00000549083 Chr17:29348593..29348696 CAGAACCTCCGCTTTGATCT Chr17:29348593..29348612 59.43 50
upstream ENSMUSE00000609782 Chr17:29348593..29348696 CAGAACCTCCGCTTTGATCT Chr17:29348593..29348612 59.43 50
upstream ENSMUSE00000549081 Chr17:29346635..29346674 CCAAGAGCCCGGATCTATCT Chr17:29346641..29346660 60.56 55
upstream ENSMUSE00000609781 Chr17:29346635..29346674 CCAAGAGCCCGGATCTATCT Chr17:29346641..29346660 60.56 55
upstream ENSMUSE00000549080 Chr17:29346369..29346445 GGCCTTCTGTACCCTTGGAG Chr17:29346412..29346431 61.01 60
upstream ENSMUSE00000609780 Chr17:29346369..29346445 GGCCTTCTGTACCCTTGGAG Chr17:29346412..29346431 61.01 60
upstream ENSMUSE00000549078 Chr17:29341634..29341693 GGAACATTCAGCCTCAACTCC Chr17:29341669..29341689 61.01 52.38
upstream ENSMUSE00000609779 Chr17:29341634..29341693 GGAACATTCAGCCTCAACTCC Chr17:29341669..29341689 61.01 52.38
upstream ENSMUSE00000549077 Chr17:29339450..29339513 CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50
upstream ENSMUSE00000609778 Chr17:29339450..29339513 CCCAGGGAAGAAATGTGGTA Chr17:29339488..29339507 59.78 50
upstream ENSMUSE00000549076 Chr17:29325238..29325341 TGTGCCAACAAGCTGGATAA Chr17:29325301..29325320 60.26 45
upstream ENSMUSE00000609777 Chr17:29325238..29325341 TGTGCCAACAAGCTGGATAA Chr17:29325301..29325320 60.26 45

*** Putative Vector Insertion (Chr 17: 29325237 - 29339514) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000549047 Chr17:29320868..29320972 TCATGACCTCCGTCTTGTGA Chr17:29320919..29320938 60.25 50
downstream ENSMUSE00000549073 Chr17:29320868..29320972 TCATGACCTCCGTCTTGTGA Chr17:29320919..29320938 60.25 50
downstream ENSMUSE00000137207 Chr17:29313107..29313148 ACACCTCCACCTTGATGGTC Chr17:29313107..29313126 59.82 55
downstream ENSMUSE00000549069 Chr17:29310270..29310345 GTGGTGAACTCCCCAATGAA Chr17:29310297..29310316 60.76 50
downstream ENSMUSE00000137215 Chr17:29306350..29306403 No primer for this exon
downstream ENSMUSE00000549066 Chr17:29303663..29303724 CTCTACCGCAAAGGAAAGCA Chr17:29303676..29303695 60.51 50
downstream ENSMUSE00000549062 Chr17:29301619..29301665 No primer for this exon
downstream ENSMUSE00000368564 Chr17:29299318..29299379 GACGTGGACTGTGAGGGATT Chr17:29299336..29299355 59.97 55
downstream ENSMUSE00000609776 Chr17:29299277..29299315 TCATAATGCTGAATGATCTCTCC Chr17:29299255..29299277 58.29 39.13
downstream ENSMUSE00000549058 Chr17:29299198..29299379 GACGTGGACTGTGAGGGATT Chr17:29299336..29299355 59.97 55
downstream ENSMUSE00000237233 Chr17:29298364..29298491 CAAAGTTAGTGGGGCCGTAA Chr17:29298367..29298386 59.99 50
downstream ENSMUSE00000137211 Chr17:29298055..29298157 CCGAGATGACACCATCAGTG Chr17:29298065..29298084 60.11 55
downstream ENSMUSE00000137218 Chr17:29297264..29297321 TGATCGACATAGGGAGTTTGG Chr17:29297275..29297295 59.94 47.62
downstream ENSMUSE00000137213 Chr17:29296897..29296970 CTGGACAATGTCTCGCTCAG Chr17:29296875..29296894 59.57 55
downstream ENSMUSE00000356211 Chr17:29293497..29296185 AGGGGCTCTATCTGCTCACA Chr17:29295549..29295568 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGAATAATCGCCTTGCAG Chr17:29339449..29339469 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCAGCCTGGAGCCTGTGT Chr17:29336484..29336504 62.91 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024008