Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33315
Trapped Gene
Notch1 (ENSMUSG00000026923)
Vector Insertion
Chr 2: 26313555 - 26317766
Public Clones (ggtc) IST12482B3 (tigm) IST14711C10 (tigm) IST12372C8 (tigm) IST15046F3 (tigm)
IST10258A4 (tigm) IST11399G1 (tigm) IST12482B3 (tigm) IST10143B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568958 (Chr2:26317668..26317765 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACAATGTGGATGCTGCT Chr2:26317716..26317735 60.27 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568958 (Chr2:26317668..26317765 -)
Downstram Exon
ENSMUSE00000355340 (Chr2:26313556..26316496 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACAATGTGGATGCTGCT Chr2:26317716..26317735 60.27 45 CCTGTGTGGCAGACTTGAGA Chr2:26316192..26316211 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697990 Chr2:26365132..26365177 ACAAATGGAGGATGGAGCAA Chr2:26365133..26365152 60.46 45
upstream ENSMUSE00000333372 Chr2:26359018..26359318 AGGAAAGAGGGCATCAGAGG Chr2:26359180..26359199 60.72 55
upstream ENSMUSE00000164286 Chr2:26357401..26357479 No primer for this exon
upstream ENSMUSE00000164298 Chr2:26340707..26340969 CACCGTGTAAGAATGCTGGA Chr2:26340894..26340913 59.72 50
upstream ENSMUSE00000164287 Chr2:26339788..26340126 ACTGGTCCCCACTGTGAACT Chr2:26339880..26339899 59.45 55
upstream ENSMUSE00000568974 Chr2:26337091..26337213 GGACGGCGTGAATACCTACA Chr2:26337118..26337137 60.91 55
upstream ENSMUSE00000568973 Chr2:26336494..26336727 GTGTGTCAATGGGTGGACTG Chr2:26336608..26336627 59.85 55
upstream ENSMUSE00000568972 Chr2:26335744..26335899 ACGTGGATGAGTGTGCTCTG Chr2:26335745..26335764 59.9 55
upstream ENSMUSE00000164293 Chr2:26335391..26335576 GCCTCAACACACTGGGTTCT Chr2:26335527..26335546 60.16 55
upstream ENSMUSE00000164282 Chr2:26334967..26335080 CCACTGCATGGACAAGATCA Chr2:26334994..26335013 60.69 50
upstream ENSMUSE00000164308 Chr2:26334127..26334240 ATGGGCCCAACACCTATACC Chr2:26334143..26334162 60.83 55
upstream ENSMUSE00000164277 Chr2:26333590..26333823 CTTATGCCTCAAGGGAACCA Chr2:26333593..26333612 60.07 50
upstream ENSMUSE00000662975 Chr2:26333400..26333510 GCTACGAATGTGCCTGTGAA Chr2:26333413..26333432 59.87 50
upstream ENSMUSE00000662974 Chr2:26332467..26332659 GCAACAGTAACCCCTGCATC Chr2:26332496..26332515 60.53 55
upstream ENSMUSE00000164302 Chr2:26331868..26332013 TGAGTCCAACCCTTGTGTCA Chr2:26331931..26331950 60.13 50
upstream ENSMUSE00000164301 Chr2:26331594..26331707 GACCTGCATTGATGATGTCG Chr2:26331630..26331649 60.08 50
upstream ENSMUSE00000698006 Chr2:26329663..26329760 GGGGTATGCAAGGAGTCTGA Chr2:26329685..26329704 60.07 55
upstream ENSMUSE00000164276 Chr2:26329641..26329760 GGGGTATGCAAGGAGTCTGA Chr2:26329685..26329704 60.07 55
upstream ENSMUSE00000164304 Chr2:26329201..26329353 CGGCTATACAGGTCGCAACT Chr2:26329231..26329250 60.29 55
upstream ENSMUSE00000164288 Chr2:26328304..26328532 GTGCCAATTGCACTGACTGT Chr2:26328384..26328403 59.76 50
upstream ENSMUSE00000698005 Chr2:26328304..26328533 GTGCCAATTGCACTGACTGT Chr2:26328384..26328403 59.76 50
upstream ENSMUSE00000164273 Chr2:26327591..26327792 CCTGCCAAGACAGCTATGGT Chr2:26327639..26327658 60.28 55
upstream ENSMUSE00000697989 Chr2:26327591..26327792 CCTGCCAAGACAGCTATGGT Chr2:26327639..26327658 60.28 55
upstream ENSMUSE00000697988 Chr2:26326685..26326825 GACGTGCTCAGTGTGTCCTG Chr2:26326695..26326714 60.53 60
upstream ENSMUSE00000164283 Chr2:26326672..26326825 GACGTGCTCAGTGTGTCCTG Chr2:26326695..26326714 60.53 60
upstream ENSMUSE00000164290 Chr2:26326342..26326526 GGACGAGTGCTCACCTAACC Chr2:26326395..26326414 59.73 60
upstream ENSMUSE00000697987 Chr2:26326342..26326528 GGCATTGACGTCACTCTCCT Chr2:26326508..26326527 60.27 55
upstream ENSMUSE00000164291 Chr2:26325794..26325926 AGATCAACGAGTGCCTGTCC Chr2:26325870..26325889 60.27 55
upstream ENSMUSE00000697986 Chr2:26325794..26325926 AGATCAACGAGTGCCTGTCC Chr2:26325870..26325889 60.27 55
upstream ENSMUSE00000164295 Chr2:26325321..26325578 TGTGTGCAGCGTGTTAATGA Chr2:26325353..26325372 59.9 45
upstream ENSMUSE00000697984 Chr2:26325321..26325578 TGTGTGCAGCGTGTTAATGA Chr2:26325353..26325372 59.9 45
upstream ENSMUSE00000698004 Chr2:26325159..26325237 CAAGAATGGGGGTGTCTGTG Chr2:26325172..26325191 61.37 55
upstream ENSMUSE00000697983 Chr2:26325155..26325237 No primer for this exon
upstream ENSMUSE00000164306 Chr2:26325125..26325237 CCCGTGGATTCATCTGTAGG Chr2:26325134..26325153 60.33 55
upstream ENSMUSE00000164285 Chr2:26323752..26324323 GTGGATGCAGGCAATAAGGT Chr2:26323953..26323972 59.96 50
upstream ENSMUSE00000697982 Chr2:26323752..26324272 GTGGATGCAGGCAATAAGGT Chr2:26323953..26323972 59.96 50
upstream ENSMUSE00000698003 Chr2:26323752..26324276 GTGGATGCAGGCAATAAGGT Chr2:26323953..26323972 59.96 50
upstream ENSMUSE00000697981 Chr2:26323232..26323550 AACAGTGCCGAATGTGAGTG Chr2:26323470..26323489 59.75 50
upstream ENSMUSE00000698002 Chr2:26323232..26323550 AACAGTGCCGAATGTGAGTG Chr2:26323470..26323489 59.75 50
upstream ENSMUSE00000164284 Chr2:26323149..26323550 AACAGTGCCGAATGTGAGTG Chr2:26323470..26323489 59.75 50
upstream ENSMUSE00000164281 Chr2:26321987..26322135 ACAAGATTGAGGCCGTGAAG Chr2:26321988..26322007 60.26 50
upstream ENSMUSE00000164305 Chr2:26320870..26321086 CAGCAAGAAGAAGCGGAGAG Chr2:26320901..26320920 60.41 55
upstream ENSMUSE00000164280 Chr2:26320583..26320670 TGGACGACAATCAGAACGAG Chr2:26320619..26320638 59.83 50
upstream ENSMUSE00000164271 Chr2:26320326..26320491 TGGATGTCAATGTTCGAGGA Chr2:26320330..26320349 60.05 45
upstream ENSMUSE00000697980 Chr2:26320326..26320371 TGGATGTCAATGTTCGAGGA Chr2:26320330..26320349 60.05 45
upstream ENSMUSE00000698000 Chr2:26320326..26320371 TGGATGTCAATGTTCGAGGA Chr2:26320330..26320349 60.05 45
upstream ENSMUSE00000697979 Chr2:26319438..26319525 GCTTCACACCCCTCATGATT Chr2:26319503..26319522 59.93 50
upstream ENSMUSE00000164307 Chr2:26319230..26319525 GCTTCACACCCCTCATGATT Chr2:26319503..26319522 59.93 50
upstream ENSMUSE00000568959 Chr2:26317862..26318009 GGCACAACTCCACTGATCCT Chr2:26317942..26317961 60.12 55
upstream ENSMUSE00000568958 Chr2:26317668..26317765 TGAACAATGTGGATGCTGCT Chr2:26317716..26317735 60.27 45
upstream ENSMUSE00000355340 Chr2:26313556..26316496 CAGGGTGAAGTTCCCTGTGT Chr2:26314744..26314763 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGAACAATGTGGATGCTG Chr2:26317716..26317736 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGAACAATGTGGATGCTG Chr2:26317716..26317736 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026923