Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33334
Trapped Gene
Tgm7 (ENSMUSG00000079103)
Vector Insertion
Chr 2: 120926694 - 120929741
Public Clones IST10343D10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684904 (Chr2:120929563..120929740 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGACAGTGGTGTGCTTCAG Chr2:120929708..120929727 59.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684904 (Chr2:120929563..120929740 -)
Downstram Exon
ENSMUSE00000684903 (Chr2:120926695..120926833 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGACAGTGGTGTGCTTCAG Chr2:120929708..120929727 59.94 55 CTCGGGTTGGAACACCTAAG Chr2:120926782..120926801 59.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684895 Chr2:120935345..120935531 CACTGAGGATTTGGGCTTGT Chr2:120935447..120935466 60.11 50
upstream ENSMUSE00000684894 Chr2:120934230..120934475 CTCGATTTTCTCACCGGCTA Chr2:120934341..120934360 60.34 50
upstream ENSMUSE00000684907 Chr2:120934230..120934386 CTCGATTTTCTCACCGGCTA Chr2:120934341..120934360 60.34 50
upstream ENSMUSE00000684906 Chr2:120932602..120932720 CTCCAGGCCTTGGAACTATG Chr2:120932607..120932626 59.69 55
upstream ENSMUSE00000684905 Chr2:120929827..120929955 AAGAACCCATCCAAAGACCA Chr2:120929876..120929895 59.38 45
upstream ENSMUSE00000684904 Chr2:120929563..120929740 ACGACAGTGGTGTGCTTCAG Chr2:120929708..120929727 59.94 55
upstream ENSMUSE00000684903 Chr2:120926695..120926833 TAGGTGTTCCAACCCGAGTC Chr2:120926802..120926821 59.97 55

*** Putative Vector Insertion (Chr 2: 120926694 - 120929741) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684902 Chr2:120924702..120924805 TCATCCAGCACTCATTCCAG Chr2:120924752..120924771 59.79 50
downstream ENSMUSE00000684901 Chr2:120924081..120924323 CGCTCATCTGACCCTACCAT Chr2:120924094..120924113 60.1 55
downstream ENSMUSE00000684900 Chr2:120922007..120922333 CAGGAGAGATGAAGCGTTCC Chr2:120922232..120922251 59.95 55
downstream ENSMUSE00000684899 Chr2:120921591..120921751 ACACGGATCAGCCTTTCATC Chr2:120921657..120921676 60.08 50
downstream ENSMUSE00000684898 Chr2:120919740..120919873 GTGTTGGTGAGGGTGATGTG Chr2:120919793..120919812 59.85 55
downstream ENSMUSE00000684897 Chr2:120919325..120919484 CAGCTTTGATGGGGTAGAGC Chr2:120919398..120919417 59.84 55
downstream ENSMUSE00000684893 Chr2:120919301..120919484 CAGCTTTGATGGGGTAGAGC Chr2:120919398..120919417 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTGGTAATCGCCTTGCAG Chr2:120929678..120929698 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACAAAATCTGGCGTGACTG Chr2:120929684..120929704 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079103