Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33336
Trapped Gene
Rhbdl2 (ENSMUSG00000043333)
Vector Insertion
Chr 4: 123465215 - 123487156
Public Clones IST12638E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458702 (Chr4:123465118..123465214 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGTGCAAGATCCGACTG Chr4:123465162..123465181 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458702 (Chr4:123465118..123465214 +)
Downstram Exon
ENSMUSE00000384440 (Chr4:123487157..123487419 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGTGCAAGATCCGACTG Chr4:123465162..123465181 59.98 50 ACTTGGAGACGATCCTGTGG Chr4:123487330..123487349 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458702 Chr4:123465118..123465214 TGAAGTGCAAGATCCGACTG Chr4:123465162..123465181 59.98 50

*** Putative Vector Insertion (Chr 4: 123465215 - 123487156) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384440 Chr4:123487157..123487419 ACTTGGAGACGATCCTGTGG Chr4:123487330..123487349 60.11 55
downstream ENSMUSE00000712345 Chr4:123487157..123487419 ACTTGGAGACGATCCTGTGG Chr4:123487330..123487349 60.11 55
downstream ENSMUSE00000668992 Chr4:123491486..123491634 CCTCTTCTCAGGGCAGTACG Chr4:123491593..123491612 60.01 60
downstream ENSMUSE00000668990 Chr4:123495107..123495219 AGCACTCCTGCCAGGTACAC Chr4:123495217..123495236 60.33 60
downstream ENSMUSE00000668989 Chr4:123500000..123500100 CAAGAGACTTGAGGGGGTCA Chr4:123500044..123500063 60.23 55
downstream ENSMUSE00000668987 Chr4:123502104..123502164 ACGATTCCAAAGGCAGGAAT Chr4:123502141..123502160 60.83 45
downstream ENSMUSE00000668986 Chr4:123504081..123504142 AGCAAATCCCATGTCTGACG Chr4:123504106..123504125 61.07 50
downstream ENSMUSE00000668984 Chr4:123506777..123507147 GAGCAGGGTCTTGTCAAAGC Chr4:123506866..123506885 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAATCGCCTTGCAGCAC Chr4:123465263..123465283 62.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCAACTCATGTCATCTCG Chr4:123465244..123465264 60.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043333