Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33342
Trapped Gene
Prrxl1 (ENSMUSG00000041730)
Vector Insertion
Chr 14: 33421640 - 33460226
Public Clones IST12947A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453406 (Chr14:33421527..33421639 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGAACACAGCCACGTATG Chr14:33421587..33421606 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453406 (Chr14:33421527..33421639 +)
Downstram Exon
ENSMUSE00000561933 (Chr14:33460227..33460378 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGAACACAGCCACGTATG Chr14:33421587..33421606 60.17 55 AAGGCTCTCTGTTGGGTCTG Chr14:33460299..33460318 59.45 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561939 Chr14:33413113..33413250 CGTCGGCGATGTTTTATTTC Chr14:33413209..33413228 60.46 45
upstream ENSMUSE00000339196 Chr14:33417082..33417179 AAACAGCGCAGAAATCGAAC Chr14:33417141..33417160 60.4 45
upstream ENSMUSE00000226119 Chr14:33418404..33418505 AGCTCTGGAGGCAGTCTTTG Chr14:33418409..33418428 59.74 55
upstream ENSMUSE00000343712 Chr14:33421262..33421440 TTGGTTCCAGAACCGAAGAG Chr14:33421264..33421283 60.22 50
upstream ENSMUSE00000453406 Chr14:33421527..33421639 CCTGAACACAGCCACGTATG Chr14:33421587..33421606 60.17 55

*** Putative Vector Insertion (Chr 14: 33421640 - 33460226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000561933 Chr14:33460227..33460378 AAGGCTCTCTGTTGGGTCTG Chr14:33460299..33460318 59.45 55
downstream ENSMUSE00000649746 Chr14:33461665..33462417 GACGTAAGGGTGGGTTAGCA Chr14:33461968..33461987 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTACAAGCCTCTGTGGAA Chr14:33427668..33427688 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTACAAGCCTCTGTGGAA Chr14:33427668..33427688 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041730