Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33348
Trapped Gene
Fut2 (ENSMUSG00000055978)
Vector Insertion
Chr 7: 52903964 - 52921765
Public Clones IST10019D4 (tigm) IST14751D6 (tigm) IST14751D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000467155 (Chr7:52921568..52921764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGGTCCTGAACGAAGAGC Chr7:52921662..52921681 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000467155 (Chr7:52921568..52921764 -)
Downstram Exon
ENSMUSE00000510922 (Chr7:52903965..52906718 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGGTCCTGAACGAAGAGC Chr7:52921662..52921681 59.99 55 TATCCCGTGAAACGCACATA Chr7:52906234..52906253 59.95 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467155 Chr7:52921568..52921764 CTTGGTCCTGAACGAAGAGC Chr7:52921662..52921681 59.99 55
upstream ENSMUSE00000510922 Chr7:52903965..52906718 GCTGATCCTGTGCATGAGAA Chr7:52904388..52904407 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCACCTGAGAGGAAGCTA Chr7:52906787..52906807 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCACCTGAGAGGAAGCTA Chr7:52906787..52906807 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055978