Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33367
Trapped Gene
Ccdc155 (ENSMUSG00000038292)
Vector Insertion
Chr 7: 52455614 - 52460263
Public Clones IST10603G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714144 (Chr7:52459962..52460262 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCCCTATTTTGTCAAGC Chr7:52460151..52460170 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714144 (Chr7:52459962..52460262 -)
Downstram Exon
ENSMUSE00000712672 (Chr7:52455615..52455755 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCCCTATTTTGTCAAGC Chr7:52460151..52460170 60.07 45 GAGGGTTGGGGAAAAGAAAG Chr7:52455698..52455717 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433295 Chr7:52459962..52460262 TTGGCCCTATTTTGTCAAGC Chr7:52460151..52460170 60.07 45
upstream ENSMUSE00000714144 Chr7:52459962..52460262 TTGGCCCTATTTTGTCAAGC Chr7:52460151..52460170 60.07 45
upstream ENSMUSE00000346303 Chr7:52455615..52455755 GAGCATCAGGAGTGGTCCAT Chr7:52455656..52455675 60.08 55
upstream ENSMUSE00000712672 Chr7:52455615..52455755 GAGCATCAGGAGTGGTCCAT Chr7:52455656..52455675 60.08 55

*** Putative Vector Insertion (Chr 7: 52455614 - 52460263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000374336 Chr7:52451877..52451981 CTGAGCAGTGGCCTTGAACT Chr7:52451911..52451930 60.59 55
downstream ENSMUSE00000338395 Chr7:52451338..52451524 ACCACCAGAAAGGTGTCCAG Chr7:52451352..52451371 60 55
downstream ENSMUSE00000376209 Chr7:52450899..52450963 TCTCCTCTGCCCGCTCTAAT Chr7:52450919..52450938 61.38 55
downstream ENSMUSE00000341297 Chr7:52449720..52449786 TGGCTGACTCCTCAGCTTCT Chr7:52449738..52449757 60.28 55
downstream ENSMUSE00000349795 Chr7:52449330..52449491 TCTCCACACTGCGTTGTAGC Chr7:52449372..52449391 60.06 55
downstream ENSMUSE00000270189 Chr7:52448829..52448946 AGACTGCGATTCTGCTCCTC Chr7:52448829..52448848 59.71 55
downstream ENSMUSE00000351730 Chr7:52448546..52448596 No primer for this exon
downstream ENSMUSE00000270172 Chr7:52445320..52445397 CTCACTCCGCCTTTTCACTC Chr7:52445328..52445347 59.99 55
downstream ENSMUSE00000359080 Chr7:52445007..52445063 GAGTCGTTCGCACTCACAGA Chr7:52445015..52445034 60.19 55
downstream ENSMUSE00000270168 Chr7:52444711..52444770 No primer for this exon
downstream ENSMUSE00000270161 Chr7:52444223..52444287 TGCTCCTCCAGGTTTGAGAT Chr7:52444231..52444250 59.8 50
downstream ENSMUSE00000347652 Chr7:52443982..52444069 GCCATGATCCAGCCTACTCT Chr7:52444003..52444022 59.27 55
downstream ENSMUSE00000393553 Chr7:52443512..52443667 AGCACTGGCTACATCCTGCT Chr7:52443625..52443644 60.04 55
downstream ENSMUSE00000432604 Chr7:52442022..52442080 TCCTTCTAGAGCACGCACTG Chr7:52442020..52442039 59.34 55
downstream ENSMUSE00000432596 Chr7:52440648..52440699 CTTCCTGGCTTCTGGACAAC Chr7:52440658..52440677 59.84 55
downstream ENSMUSE00000432590 Chr7:52439559..52439623 TGGTGATAGGTTCCCAGAGG Chr7:52439567..52439586 59.92 55
downstream ENSMUSE00000432581 Chr7:52439362..52439478 ACTGGCACCAGGTCTCTCAC Chr7:52439394..52439413 60.31 60
downstream ENSMUSE00000433275 Chr7:52439047..52439261 CATGCTGACGGAGGAGGTAT Chr7:52439060..52439079 60.1 55
downstream ENSMUSE00000713310 Chr7:52439046..52439261 CATGCTGACGGAGGAGGTAT Chr7:52439060..52439079 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCGCATCATTGTGACAG Chr7:52460265..52460285 60.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGCGCATCATTGTGACAG Chr7:52460265..52460285 60.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038292