Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33372
Trapped Gene
Gucy1a2 (ENSMUSG00000041624)
Vector Insertion
Chr 9: 3533100 - 3579517
Public Clones (sanger) IST10291C7 (tigm) IST11827A3 (tigm) IST14732H6 (tigm) IST10519E1 (tigm)
IST14516B2 (tigm) IST14447A11 (tigm) IST11827A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503355 (Chr9:3532354..3533099 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAGCATGTCTCGAAGAA Chr9:3532796..3532815 60.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503355 (Chr9:3532354..3533099 +)
Downstram Exon
ENSMUSE00000261127 (Chr9:3579518..3579579 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAGCATGTCTCGAAGAA Chr9:3532796..3532815 60.29 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503355 Chr9:3532354..3533099 CAGCAGCATGTCTCGAAGAA Chr9:3532796..3532815 60.29 50

*** Putative Vector Insertion (Chr 9: 3533100 - 3579517) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261127 Chr9:3579518..3579579 No primer for this exon
downstream ENSMUSE00000261112 Chr9:3582579..3582700 CTTTGTTGGAATGGTCTGCAT Chr9:3582651..3582671 59.99 42.86
downstream ENSMUSE00000585153 Chr9:3634439..3635157 GCAGAAGGTGTTGATGCTGA Chr9:3634926..3634945 59.99 50
downstream ENSMUSE00000703981 Chr9:3634439..3635161 GCAGAAGGTGTTGATGCTGA Chr9:3634926..3634945 59.99 50
downstream ENSMUSE00000703980 Chr9:3635972..3635981 No primer for this exon
downstream ENSMUSE00000703979 Chr9:3636707..3636723 No primer for this exon
downstream ENSMUSE00000703978 Chr9:3637253..3637260 No primer for this exon
downstream ENSMUSE00000703977 Chr9:3758917..3758925 No primer for this exon
downstream ENSMUSE00000261056 Chr9:3759396..3759881 TGCATGGGAGTACACTGAGC Chr9:3759814..3759833 59.86 55
downstream ENSMUSE00000261038 Chr9:3797238..3797381 TTTCCATCGGGAGTCAGAAC Chr9:3797374..3797393 60.05 50
downstream ENSMUSE00000261015 Chr9:3865358..3865512 GACATTGATACGCCGAGGAT Chr9:3865498..3865517 59.92 50
downstream ENSMUSE00000407368 Chr9:3894504..3897342 GGCAAAATTGCCTGACAGAT Chr9:3895778..3895797 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGAGTTGGGAAGAGAGG Chr9:3536099..3536119 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGAGTTGGGAAGAGAGG Chr9:3536099..3536119 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041624