Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33383
Trapped Gene
Atp11c (ENSMUSG00000062949)
Vector Insertion
Chr X: 57519912 - 57523175
Public Clones IST11301B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655576 (ChrX:57522911..57523174 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCTTACTGGGGACAAGA ChrX:57523095..57523114 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655576 (ChrX:57522911..57523174 -)
Downstram Exon
ENSMUSE00000488920 (ChrX:57519913..57520087 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCTTACTGGGGACAAGA ChrX:57523095..57523114 60.11 55 TCCTGATGTTCTGTCCATGC ChrX:57520045..57520064 59.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454335 ChrX:57656980..57657156 No primer for this exon
upstream ENSMUSE00000655595 ChrX:57574611..57574730 CGAGTTGGTACACGCACAGT ChrX:57574693..57574712 59.82 55
upstream ENSMUSE00000655594 ChrX:57562893..57562982 No primer for this exon
upstream ENSMUSE00000655593 ChrX:57560374..57560454 AACCAGCCCAGTTACCAGTG ChrX:57560418..57560437 60.03 55
upstream ENSMUSE00000655592 ChrX:57557402..57557509 GCAAAGCGAGTGAGGAAAGA ChrX:57557418..57557437 60.66 50
upstream ENSMUSE00000655591 ChrX:57550138..57550266 TCCTGCACAACTGATGGAAC ChrX:57550184..57550203 59.68 50
upstream ENSMUSE00000655590 ChrX:57548366..57548469 TGCACTGTGTACAGCCGAAT ChrX:57548424..57548443 60.33 50
upstream ENSMUSE00000655589 ChrX:57546784..57546834 TTTGTTGGGCGAATCAGTATC ChrX:57546813..57546833 59.95 42.86
upstream ENSMUSE00000655587 ChrX:57545496..57545560 TGCTGAAAGGAGCCACACTT ChrX:57545518..57545537 60.97 50
upstream ENSMUSE00000655586 ChrX:57545097..57545178 TGCTGTTTACACTGGGATGG ChrX:57545155..57545174 59.57 50
upstream ENSMUSE00000655585 ChrX:57543747..57543897 TTTGGCAAAGTTCCCCATAC ChrX:57543801..57543820 59.8 45
upstream ENSMUSE00000655584 ChrX:57543071..57543268 No primer for this exon
upstream ENSMUSE00000655583 ChrX:57534745..57534906 GATGGGCCCTTAGCCTATTT ChrX:57534761..57534780 59.42 50
upstream ENSMUSE00000655581 ChrX:57533834..57533985 GAAGGAGCCGGATTCACATA ChrX:57533882..57533901 60.04 50
upstream ENSMUSE00000655580 ChrX:57533209..57533280 GGGTTCACATTTTTGGGAAA ChrX:57533257..57533276 59.64 40
upstream ENSMUSE00000655579 ChrX:57531971..57532044 No primer for this exon
upstream ENSMUSE00000655578 ChrX:57530554..57530657 CCCAGGGTACATAGCCATCA ChrX:57530594..57530613 60.73 55
upstream ENSMUSE00000655577 ChrX:57529785..57529966 GCAAAAATGGCCCTACAAGA ChrX:57529866..57529885 60.07 45
upstream ENSMUSE00000655576 ChrX:57522911..57523174 GGTGCTTACTGGGGACAAGA ChrX:57523095..57523114 60.11 55
upstream ENSMUSE00000488920 ChrX:57519913..57520087 TGATGGCTCCACATTGTCAC ChrX:57520032..57520051 60.54 50

*** Putative Vector Insertion (Chr X: 57519912 - 57523175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206791 ChrX:57514829..57514931 TTGGCACCATCACCTATTGA ChrX:57514845..57514864 59.92 45
downstream ENSMUSE00000206797 ChrX:57513338..57513483 CTTGACGGCCTTCTTTTCCT ChrX:57513435..57513454 60.73 50
downstream ENSMUSE00000488021 ChrX:57501066..57501125 TGGCAAAATGAAACAAAGGTT ChrX:57501083..57501103 59.48 33.33
downstream ENSMUSE00000206784 ChrX:57498341..57498468 GGGTCTGCGGTCAGAGTATC ChrX:57498331..57498350 59.69 60
downstream ENSMUSE00000206779 ChrX:57495939..57496074 AATGTAAGAAGGGCCCCAAC ChrX:57496006..57496025 60.19 50
downstream ENSMUSE00000206794 ChrX:57493950..57494015 AACAATGGTTCCAAATGTCCA ChrX:57493961..57493981 60.08 38.1
downstream ENSMUSE00000206774 ChrX:57491647..57491750 TCCTCCCCAGAAGAATGAGA ChrX:57491633..57491652 59.73 50
downstream ENSMUSE00000498939 ChrX:57489734..57489887 CAGAGCATTTGAGCAAACACA ChrX:57489815..57489835 60.04 42.86
downstream ENSMUSE00000655574 ChrX:57482325..57482429 GAAGGTCTGGCGGATAATGA ChrX:57482358..57482377 60.04 50
downstream ENSMUSE00000453967 ChrX:57476470..57478970 CTGCAACCACGGTCAATATG ChrX:57478890..57478909 59.99 50
downstream ENSMUSE00000655575 ChrX:57476470..57478970 CTGCAACCACGGTCAATATG ChrX:57478890..57478909 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGAGACCATTGAAGCTC ChrX:57520138..57520158 59.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCGTGACTGGGAAAACC ChrX:57520108..57520128 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062949