Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33398
Trapped Gene
Ccdc33 (ENSMUSG00000037716)
Vector Insertion
Chr 9: 57929766 - 57934484
Public Clones IST14731G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000478396 (Chr9:57934350..57934483 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCGATGACCTCTGTGACC Chr9:57934426..57934445 60.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000478396 (Chr9:57934350..57934483 -)
Downstram Exon
ENSMUSE00000348848 (Chr9:57929767..57929876 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCGATGACCTCTGTGACC Chr9:57934426..57934445 60.27 55 GTGGAAGATGCGCAGGTATT Chr9:57929769..57929788 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636487 Chr9:57966242..57966551 AGGTCATTGAGCAGCAGGAT Chr9:57966297..57966316 59.83 50
upstream ENSMUSE00000698303 Chr9:57966242..57966630 AGGTCATTGAGCAGCAGGAT Chr9:57966297..57966316 59.83 50
upstream ENSMUSE00000636486 Chr9:57965110..57965438 CCATTTACCCACGACCAGAT Chr9:57965311..57965330 59.67 50
upstream ENSMUSE00000636484 Chr9:57964894..57965010 GAGGCCCTGAGTGACAAGAT Chr9:57964982..57965001 59.26 55
upstream ENSMUSE00000636474 Chr9:57962104..57962146 CAGAGCTGTTGAAGAGGGAAA Chr9:57962125..57962145 59.6 47.62
upstream ENSMUSE00000636473 Chr9:57959789..57959826 TTTTCTCAGCCTCTGCTTCC Chr9:57959799..57959818 59.69 50
upstream ENSMUSE00000255807 Chr9:57949729..57950104 CTCCCACTCAACATCCCCTA Chr9:57949921..57949940 59.92 55
upstream ENSMUSE00000713727 Chr9:57949729..57950032 CTCCCACTCAACATCCCCTA Chr9:57949921..57949940 59.92 55
upstream ENSMUSE00000255794 Chr9:57946322..57946485 CATATCCTGCCGCCAACTAC Chr9:57946423..57946442 60.49 55
upstream ENSMUSE00000478396 Chr9:57934350..57934483 AAGCGATGACCTCTGTGACC Chr9:57934426..57934445 60.27 55
upstream ENSMUSE00000348848 Chr9:57929767..57929876 TGTCCTACGACATCCCCATT Chr9:57929812..57929831 60.19 50

*** Putative Vector Insertion (Chr 9: 57929766 - 57934484) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255895 Chr9:57928584..57928691 CAACGTAGCGGGGAAGTAAG Chr9:57928585..57928604 59.76 55
downstream ENSMUSE00000255876 Chr9:57925345..57925436 TAAGGGCTCGTTGACTCCTC Chr9:57925385..57925404 59.43 55
downstream ENSMUSE00000255859 Chr9:57924345..57924465 GATCCGAGGCACATCAAAGT Chr9:57924344..57924363 60.08 50
downstream ENSMUSE00000255845 Chr9:57917644..57917773 GGCTTGGAAGAGGAAGGACT Chr9:57917689..57917708 59.82 55
downstream ENSMUSE00000410238 Chr9:57916896..57917029 CCCTTGCAAGTGTTTTCCTG Chr9:57916901..57916920 60.66 50
downstream ENSMUSE00000383171 Chr9:57915310..57915381 AAGCAGCTGGAAGGAGAGGT Chr9:57915297..57915316 60.53 55
downstream ENSMUSE00000334917 Chr9:57906048..57906203 TAGGATCTTGGGGTTGATGG Chr9:57906116..57906135 59.74 50
downstream ENSMUSE00000413809 Chr9:57881363..57881522 TTCTATGCTCTGCTGGCTCA Chr9:57881372..57881391 59.85 50
downstream ENSMUSE00000359461 Chr9:57881027..57881118 CTGTCTCGCAGCCTCTTCAT Chr9:57881036..57881055 60.7 55
downstream ENSMUSE00000721711 Chr9:57881027..57881115 TGTCTCGCAGCCTCTTCATA Chr9:57881037..57881056 59.7 50
downstream ENSMUSE00000256002 Chr9:57880672..57880803 GCTGAGCCTGGTACAGAAGC Chr9:57880736..57880755 60.16 60
downstream ENSMUSE00000255988 Chr9:57880489..57880582 CATGATAGGCTTCCCCTGTG Chr9:57880468..57880487 60.47 55
downstream ENSMUSE00000255971 Chr9:57879422..57879570 GAAGCCTCGTGTTTTCTGCT Chr9:57879465..57879484 59.62 50
downstream ENSMUSE00000636478 Chr9:57878863..57879069 CCTTTCTGCCAAATCTCCAC Chr9:57879003..57879022 59.67 50
downstream ENSMUSE00000255957 Chr9:57878141..57878227 CTAGCTTGGCCAGGAGGTTA Chr9:57878157..57878176 59.47 55
downstream ENSMUSE00000377124 Chr9:57877655..57877768 AAAGCCGTGTTGTTGCTCTT Chr9:57877669..57877688 59.92 45
downstream ENSMUSE00000719305 Chr9:57876489..57876690 GAGATCTGCTCCGGTCTCAG Chr9:57876527..57876546 60.1 60
downstream ENSMUSE00000506153 Chr9:57876484..57876690 GAGATCTGCTCCGGTCTCAG Chr9:57876527..57876546 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGTCCTCAAGCGATGACC Chr9:57934433..57934453 60.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGTCCTCAAGCGATGACC Chr9:57934433..57934453 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037716