Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33405
Trapped Gene
Zfp454 (ENSMUSG00000048728)
Vector Insertion
Chr 11: 50686226 - 50691434
Public Clones IST11154C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000591493 (Chr11:50691384..50691433 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATATCACAGCAGGCAAGG Chr11:50691400..50691419 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000591493 (Chr11:50691384..50691433 -)
Downstram Exon
ENSMUSE00000679119 (Chr11:50686227..50687789 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATATCACAGCAGGCAAGG Chr11:50691400..50691419 60.62 55 GATGTGCTCTGCAAACGAAA Chr11:50687099..50687118 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377657 Chr11:50700895..50701153 CGCTTTATCGCTTTTTGCTC Chr11:50701119..50701138 60.12 45
upstream ENSMUSE00000679120 Chr11:50700868..50700945 GGTCAGGTCTGGGAGTTGAG Chr11:50700876..50700895 59.68 60
upstream ENSMUSE00000710808 Chr11:50699871..50700000 CCCCAGCAATTGTAAAGCTC Chr11:50699955..50699974 59.71 50
upstream ENSMUSE00000714572 Chr11:50699871..50700000 CCCCAGCAATTGTAAAGCTC Chr11:50699955..50699974 59.71 50
upstream ENSMUSE00000580003 Chr11:50697187..50697313 CAGAGGGCCTTGTATCAGGA Chr11:50697225..50697244 60.21 55
upstream ENSMUSE00000457962 Chr11:50696686..50696778 CTCCTGAGGGCTTTGTTCTG Chr11:50696687..50696706 59.98 55
upstream ENSMUSE00000457955 Chr11:50691545..50691607 AAGCTCAGGTTCCGGTTACA Chr11:50691546..50691565 59.73 50
upstream ENSMUSE00000591493 Chr11:50691384..50691433 GGATATCACAGCAGGCAAGG Chr11:50691400..50691419 60.62 55
upstream ENSMUSE00000679119 Chr11:50686227..50687789 TTTCGTTTGCAGAGCACATC Chr11:50687121..50687140 59.99 45

*** Putative Vector Insertion (Chr 11: 50686226 - 50691434) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391122 Chr11:50686222..50687789 GATGTGCTCTGCAAACGAAA Chr11:50687099..50687118 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:50691363..50691383 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000048728