Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33410
Trapped Gene
Hs2st1 (ENSMUSG00000040151)
Vector Insertion
Chr 3: 144094078 - 144098584
Public Clones IST12548G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270681 (Chr3:144098426..144098583 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAGCTCGAGGACTTCAT Chr3:144098488..144098507 58.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270681 (Chr3:144098426..144098583 -)
Downstram Exon
ENSMUSE00000478936 (Chr3:144094079..144097678 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAGCTCGAGGACTTCAT Chr3:144098488..144098507 58.57 55 GAATCCATTCGCTCCAAAAA Chr3:144094855..144094874 60.02 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000492150 Chr3:144232698..144233103 ATGGGGCTCCTCAGGATTAT Chr3:144232802..144232821 59.75 50
upstream ENSMUSE00000669042 Chr3:144128728..144128752 No primer for this exon
upstream ENSMUSE00000373159 Chr3:144128011..144128249 CAGGATGCAACTCTGGATGA Chr3:144128165..144128184 59.79 50
upstream ENSMUSE00000270714 Chr3:144116916..144117001 ACCACCTGGAACGAGATGAA Chr3:144116961..144116980 60.51 50
upstream ENSMUSE00000270703 Chr3:144110234..144110372 AGGAGACGGAAACAAGGAGA Chr3:144110241..144110260 58.87 50
upstream ENSMUSE00000270691 Chr3:144100559..144100656 CAGATCCCGTTCTTCTGTGG Chr3:144100577..144100596 60.65 55
upstream ENSMUSE00000270681 Chr3:144098426..144098583 GAGGAGCTCGAGGACTTCAT Chr3:144098488..144098507 58.57 55
upstream ENSMUSE00000478936 Chr3:144094079..144097678 CTGTTGGAAAGTCGCTGTCA Chr3:144095208..144095227 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCATTTAATCGCCTTGC Chr3:144098521..144098541 59.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGATTTCGTGACCGAGT Chr3:144098606..144098626 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040151