Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33417
Trapped Gene
Ptprg (ENSMUSG00000021745)
Vector Insertion
Chr 14: 12942648 - 12954491
Public Clones IST14582G9 (tigm) IST10748A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000484478 (Chr14:12942490..12942647 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATTCTCCGAGACCTCCTG Chr14:12942514..12942533 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000484478 (Chr14:12942490..12942647 +)
Downstram Exon
ENSMUSE00000489229 (Chr14:12954492..12954684 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATTCTCCGAGACCTCCTG Chr14:12942514..12942533 60.34 55 GCCTAGTGGGTTGTCCAAGA Chr14:12954671..12954690 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490031 Chr14:12386046..12386846 ATCGTCCCTAGCTTGGCTTT Chr14:12386536..12386555 60.23 50
upstream ENSMUSE00000487137 Chr14:12553629..12553733 GACAGGACAGCTCAGTGCAG Chr14:12553668..12553687 59.76 60
upstream ENSMUSE00000488184 Chr14:12785230..12785409 ATGGGTTTGACAACGAGTCC Chr14:12785353..12785372 59.83 50
upstream ENSMUSE00000493040 Chr14:12795088..12795236 CCATCCTGCTGAAAGACGAT Chr14:12795091..12795110 60.22 50
upstream ENSMUSE00000486138 Chr14:12869855..12869950 GACAGCTTTCAAACGGCAAT Chr14:12869888..12869907 60.26 45
upstream ENSMUSE00000483484 Chr14:12923929..12923995 TATTATCCACGGGCTGAAGG Chr14:12923961..12923980 59.92 50
upstream ENSMUSE00000484478 Chr14:12942490..12942647 TCATTCTCCGAGACCTCCTG Chr14:12942514..12942533 60.34 55

*** Putative Vector Insertion (Chr 14: 12942648 - 12954491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000489229 Chr14:12954492..12954684 GCCTAGTGGGTTGTCCAAGA Chr14:12954671..12954690 60.11 55
downstream ENSMUSE00000482667 Chr14:12974898..12975082 TGCAGAGCTGTCTGGTTCAG Chr14:12974958..12974977 60.33 55
downstream ENSMUSE00000479925 Chr14:12977890..12977998 AAAGGCTATCGGGTGAGACA Chr14:12977929..12977948 59.69 50
downstream ENSMUSE00000480906 Chr14:12984530..12984579 CCTTGGAAGATCCGGGTAGT Chr14:12984557..12984576 60.32 55
downstream ENSMUSE00000485611 Chr14:12986172..12986940 TCTGTACCCTCGCTGTCCTT Chr14:12986530..12986549 59.87 55
downstream ENSMUSE00000479156 Chr14:12999259..12999391 AGCATGCCAGAGGTGTTCTT Chr14:12999286..12999305 59.87 50
downstream ENSMUSE00000476346 Chr14:13011778..13011864 CCCAGAAGAAGGCACTTCAC Chr14:13011844..13011863 59.84 55
downstream ENSMUSE00000710844 Chr14:13022457..13022590 GGAGCACACAGTGGTCATCA Chr14:13022573..13022592 60.76 55
downstream ENSMUSE00000477359 Chr14:13023196..13023287 CCGGGATGGGAATAATAGGA Chr14:13023290..13023309 60.84 50
downstream ENSMUSE00000482159 Chr14:13032236..13032327 GCTCACCGATGTGTTTACCA Chr14:13032289..13032308 59.57 50
downstream ENSMUSE00000474718 Chr14:13039798..13039894 TTGTTATCCGGATGATTGGAA Chr14:13039864..13039884 60.14 38.1
downstream ENSMUSE00000472857 Chr14:13042782..13042864 No primer for this exon
downstream ENSMUSE00000294885 Chr14:13043054..13043188 GCAATGTAGGCTTTCGCTTT Chr14:13043085..13043104 59.5 45
downstream ENSMUSE00000120438 Chr14:13044099..13044233 AAAGACGACGGACGGTGTAG Chr14:13044210..13044229 60.17 55
downstream ENSMUSE00000294867 Chr14:13046148..13046320 AGATGACCTCCTCACGAAGG Chr14:13046279..13046298 59.25 55
downstream ENSMUSE00000471722 Chr14:13047702..13047837 ACAATGTAGGTGCCTGTCCTG Chr14:13047736..13047756 60.04 52.38
downstream ENSMUSE00000469697 Chr14:13048376..13048522 CTTTTCCAGCCGTGTCTTTC Chr14:13048516..13048535 59.85 50
downstream ENSMUSE00000467625 Chr14:13051453..13051546 GGCACAACAGACGAGTTCCT Chr14:13051547..13051566 60.31 55
downstream ENSMUSE00000464689 Chr14:13052523..13052599 No primer for this exon
downstream ENSMUSE00000351959 Chr14:13053106..13053234 GGCAGCATGACAATGATCTG Chr14:13053221..13053240 60.23 50
downstream ENSMUSE00000462585 Chr14:13057984..13058130 TCGGCCAGTACACAAACTCA Chr14:13058014..13058033 60.3 50
downstream ENSMUSE00000460554 Chr14:13058826..13058968 ACACTGAAAGTGCCGAACCT Chr14:13058864..13058883 59.77 50
downstream ENSMUSE00000515706 Chr14:13069543..13069678 ACAAGGTGGTAAGGGCACAC Chr14:13069592..13069611 59.89 55
downstream ENSMUSE00000519838 Chr14:13070241..13071077 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55
downstream ENSMUSE00000714956 Chr14:13070241..13074555 GCTGTCCTGCAAAAGGAGAC Chr14:13070897..13070916 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCGGTGGTTCAAAAGTA Chr14:12945652..12945672 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCGGTGGTTCAAAAGTA Chr14:12945652..12945672 61.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021745