Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33418
Trapped Gene
AL671335.12 (ENSMUSG00000073288)
Vector Insertion
Chr X: 10284301 - 10294369
Public Clones IST14837G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656640 (ChrX:10294016..10294368 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCAGTCCGGAAATTTAGC ChrX:10294231..10294250 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656640 (ChrX:10294016..10294368 -)
Downstram Exon
ENSMUSE00000656639 (ChrX:10284302..10285414 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCAGTCCGGAAATTTAGC ChrX:10294231..10294250 59.85 50 TAGTTTGAATGGGGCCTGTC ChrX:10284644..10284663 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656640 ChrX:10294016..10294368 CTGCAGTCCGGAAATTTAGC ChrX:10294231..10294250 59.85 50
upstream ENSMUSE00000656639 ChrX:10284302..10285414 TGTTGCTGGCTGAGATTTTG ChrX:10284968..10284987 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTCCTAATCGCCTTGCAG ChrX:10294304..10294325 60.9 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCTCCCGTGACTGGGAAAAC ChrX:10294303..10294325 63.87 54.54 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073288