Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3342
Trapped Gene
Kpna2 (ENSMUSG00000018362)
Vector Insertion
Chr 11: 106852647 - 106852726
Public Clones AB0013 (sanger) AS0112 (sanger) XB777 (baygenomics) XB793 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108616 (Chr11:106852727..106852821 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108616 (Chr11:106852727..106852821 -)
Downstram Exon
ENSMUSE00000108617 (Chr11:106852383..106852646 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000324280 Chr11:106860673..106860778 No primer for this exon
upstream ENSMUSE00000671093 Chr11:106860673..106860683 No primer for this exon
upstream ENSMUSE00000324273 Chr11:106858552..106858649 No primer for this exon
upstream ENSMUSE00000716045 Chr11:106858552..106858649 No primer for this exon
upstream ENSMUSE00000337527 Chr11:106857823..106857960 No primer for this exon
upstream ENSMUSE00000671092 Chr11:106857529..106857960 No primer for this exon
upstream ENSMUSE00000382812 Chr11:106853917..106854005 No primer for this exon
upstream ENSMUSE00000401609 Chr11:106853172..106853440 No primer for this exon
upstream ENSMUSE00000108616 Chr11:106852727..106852821 No primer for this exon

*** Putative Vector Insertion (Chr 11: 106852647 - 106852726) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108617 Chr11:106852383..106852646 No primer for this exon
downstream ENSMUSE00000367942 Chr11:106851953..106852186 No primer for this exon
downstream ENSMUSE00000481622 Chr11:106851503..106851685 No primer for this exon
downstream ENSMUSE00000482472 Chr11:106850638..106850787 No primer for this exon
downstream ENSMUSE00000324191 Chr11:106849950..106850293 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCACTGTTGGCACTTCT Chr11:106852753..106852773 60.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCCACTGTTGGCACTTCT Chr11:106852753..106852773 60.16 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018362