Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33436
Trapped Gene
Zcchc10 (ENSMUSG00000018239)
Vector Insertion
Chr 11: 53140930 - 53144188
Public Clones IST14612A9 (tigm) IST14170F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103815 (Chr11:53140771..53140929 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103815 (Chr11:53140771..53140929 +)
Downstram Exon
ENSMUSE00000103823 (Chr11:53144189..53144233 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000103821 Chr11:53138184..53138243 No primer for this exon
upstream ENSMUSE00000103815 Chr11:53140771..53140929 No primer for this exon

*** Putative Vector Insertion (Chr 11: 53140930 - 53144188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103823 Chr11:53144189..53144233 No primer for this exon
downstream ENSMUSE00000374181 Chr11:53145804..53146790 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATTATTGCTGCAAAGGTAGGT Chr11:53143914..53143937 58.44 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATTATTGCTGCAAAGGTAGGT Chr11:53143914..53143937 58.44 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018239