Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33447
Trapped Gene
Klhl12 (ENSMUSG00000026455)
Vector Insertion
Chr 1: 136352243 - 136355004
Public Clones IST13785G6 (tigm) IST14131D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539138 (Chr1:136352108..136352242 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGTTTACCACGGAGACTG Chr1:136352120..136352140 60.16 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539138 (Chr1:136352108..136352242 +)
Downstram Exon
ENSMUSE00000690839 (Chr1:136355005..136355243 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGTTTACCACGGAGACTG Chr1:136352120..136352140 60.16 52.38 CACATCACAGAGGGTGTTGC Chr1:136355156..136355175 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539138 Chr1:136352108..136352242 TGGAGTTTACCACGGAGACTG Chr1:136352120..136352140 60.16 52.38
upstream ENSMUSE00000706808 Chr1:136352132..136352242 No primer for this exon

*** Putative Vector Insertion (Chr 1: 136352243 - 136355004) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690839 Chr1:136355005..136355243 CACATCACAGAGGGTGTTGC Chr1:136355156..136355175 60.16 55
downstream ENSMUSE00000711567 Chr1:136355005..136355243 CACATCACAGAGGGTGTTGC Chr1:136355156..136355175 60.16 55
downstream ENSMUSE00000159332 Chr1:136355043..136355243 CACATCACAGAGGGTGTTGC Chr1:136355156..136355175 60.16 55
downstream ENSMUSE00000159329 Chr1:136360404..136360557 AACATACGGCTTCCCCTTCT Chr1:136360433..136360452 59.96 50
downstream ENSMUSE00000159333 Chr1:136364228..136364445 CTGAATCTCGTCGCACTTGA Chr1:136364448..136364467 60.14 50
downstream ENSMUSE00000159339 Chr1:136368971..136369120 TAATGTACCTGGGGGTCAGC Chr1:136369103..136369122 59.81 55
downstream ENSMUSE00000159327 Chr1:136372365..136372479 AGTTCAGGCCTCAGGTGAAA Chr1:136372441..136372460 59.84 50
downstream ENSMUSE00000159340 Chr1:136380324..136380430 CTCCTGTGTCTTGGGGTCAT Chr1:136380418..136380437 59.96 55
downstream ENSMUSE00000159324 Chr1:136382295..136382490 AGGCCACATACCGTCTCTTG Chr1:136382328..136382347 60.13 55
downstream ENSMUSE00000159335 Chr1:136383587..136383745 GATTATTCCGCTGGCCACTA Chr1:136383738..136383757 60.06 50
downstream ENSMUSE00000159338 Chr1:136384221..136384319 No primer for this exon
downstream ENSMUSE00000379981 Chr1:136385512..136385698 GAGTCTCCCTCGAAGCACTG Chr1:136385687..136385706 60.13 60
downstream ENSMUSE00000690837 Chr1:136385593..136385698 GAGTCTCCCTCGAAGCACTG Chr1:136385687..136385706 60.13 60
downstream ENSMUSE00000331773 Chr1:136385909..136387595 CGAAGGAGAGTGTGCATCAA Chr1:136386203..136386222 59.98 50
downstream ENSMUSE00000690835 Chr1:136385909..136387450 CGAAGGAGAGTGTGCATCAA Chr1:136386203..136386222 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACACACGGCCTTTCCCTCT Chr1:136352262..136352282 63.82 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACACGGCCTTTCCCTCT Chr1:136352262..136352282 63.82 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026455