Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33448
Trapped Gene
Dmtf1 (ENSMUSG00000042508)
Vector Insertion
Chr 5: 9132455 - 9136143
Public Clones (sanger) IST11629B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336817 (Chr5:9136066..9136142 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACATCGAGCGCTATCTGA Chr5:9136068..9136087 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336817 (Chr5:9136066..9136142 -)
Downstram Exon
ENSMUSE00000310074 (Chr5:9132456..9132613 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACATCGAGCGCTATCTGA Chr5:9136068..9136087 60.12 50 TACATGCGCAGCACTCTTCT Chr5:9132458..9132477 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655995 Chr5:9161614..9161718 TCCTGGTTCTTCCAAAGTGC Chr5:9161632..9161651 60.23 50
upstream ENSMUSE00000508078 Chr5:9151798..9151918 GGTGGGATTCTATGGGAAGG Chr5:9151825..9151844 60.52 55
upstream ENSMUSE00000463616 Chr5:9150376..9150492 ACGGACGGGAATCTCATTCT Chr5:9150393..9150412 60.85 50
upstream ENSMUSE00000655990 Chr5:9148900..9149022 TGCATATCAGTCGTGGCACT Chr5:9148905..9148924 60.3 50
upstream ENSMUSE00000553719 Chr5:9140386..9140480 CATGACGGCAACTACAGAGG Chr5:9140430..9140449 59.31 55
upstream ENSMUSE00000310082 Chr5:9137126..9137240 GCCAAGCGTGGTTTACAACT Chr5:9137157..9137176 60.18 50
upstream ENSMUSE00000336817 Chr5:9136066..9136142 CAACATCGAGCGCTATCTGA Chr5:9136068..9136087 60.12 50
upstream ENSMUSE00000310074 Chr5:9132456..9132613 TAGAAGAGTGCTGCGCATGT Chr5:9132481..9132500 59.77 50

*** Putative Vector Insertion (Chr 5: 9132455 - 9136143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334441 Chr5:9131276..9131308 GAGCTTCTCGATCTCTTCAGGA Chr5:9131259..9131280 60.23 50
downstream ENSMUSE00000389206 Chr5:9130541..9130652 ATTGTGTGGGGTCCACAGTT Chr5:9130609..9130628 60.13 50
downstream ENSMUSE00000309992 Chr5:9130368..9130477 CCAGTCATTGCCGTGTTTTA Chr5:9130428..9130447 59.58 45
downstream ENSMUSE00000309982 Chr5:9129148..9129376 AGCCATTTAGAACGGCATTG Chr5:9129198..9129217 60.1 45
downstream ENSMUSE00000309973 Chr5:9127957..9128108 CACTGTGGTGAACGGACACT Chr5:9128000..9128019 59.62 55
downstream ENSMUSE00000553716 Chr5:9126540..9126643 AGACGTGGGTGATCTGGACT Chr5:9126518..9126537 59.56 55
downstream ENSMUSE00000553733 Chr5:9126540..9126749 AGACGTGGGTGATCTGGACT Chr5:9126518..9126537 59.56 55
downstream ENSMUSE00000309959 Chr5:9124442..9124527 AGCAGGGGAGTCTGTTGAAG Chr5:9124486..9124505 59.45 55
downstream ENSMUSE00000553714 Chr5:9124442..9124527 AGCAGGGGAGTCTGTTGAAG Chr5:9124486..9124505 59.45 55
downstream ENSMUSE00000702578 Chr5:9122384..9122461 TTAAGGCATGTCCCCTTGTC Chr5:9122385..9122404 59.93 50
downstream ENSMUSE00000485999 Chr5:9121782..9121937 CTGGAGTACCAGTGGGCTGT Chr5:9121885..9121904 60.17 60
downstream ENSMUSE00000655981 Chr5:9121782..9121937 CTGGAGTACCAGTGGGCTGT Chr5:9121885..9121904 60.17 60
downstream ENSMUSE00000464162 Chr5:9121085..9121462 GGTCAGTGTCGGCAATTTCT Chr5:9121113..9121132 60.12 50
downstream ENSMUSE00000629056 Chr5:9121085..9121462 GGTCAGTGTCGGCAATTTCT Chr5:9121113..9121132 60.12 50
downstream ENSMUSE00000462846 Chr5:9120350..9120494 GGTGCACTATGGTGGGAGAC Chr5:9120445..9120464 60.4 60
downstream ENSMUSE00000655977 Chr5:9120350..9120494 GGTGCACTATGGTGGGAGAC Chr5:9120445..9120464 60.4 60
downstream ENSMUSE00000467208 Chr5:9118841..9120138 AGCAATGGGTTAACCAGCAC Chr5:9119510..9119529 60 50
downstream ENSMUSE00000655983 Chr5:9118841..9120138 AGCAATGGGTTAACCAGCAC Chr5:9119510..9119529 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGTGGTCCAAGGAAGAA Chr5:9133103..9133123 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATGTGGTCCAAGGAAGAA Chr5:9133103..9133123 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042508