Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33523
Trapped Gene
Ano8 (ENSMUSG00000034863)
Vector Insertion
Chr 8: 74000283 - 74002731
Public Clones IST13927G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434352 (Chr8:74002620..74002730 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGGTAGCTGAGGAGATG Chr8:74002656..74002675 59.97 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434352 (Chr8:74002620..74002730 -)
Downstram Exon
ENSMUSE00000581917 (Chr8:74000284..74000820 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGGTAGCTGAGGAGATG Chr8:74002656..74002675 59.97 60 CAACGGGATGATCTGCTTCA Chr8:74000535..74000554 62.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607182 Chr8:74009653..74009862 No primer for this exon
upstream ENSMUSE00000581923 Chr8:74008899..74009009 No primer for this exon
upstream ENSMUSE00000581922 Chr8:74008648..74008780 TTCTTTGTCACCGCCACATA Chr8:74008654..74008673 60.11 45
upstream ENSMUSE00000581921 Chr8:74008333..74008471 TCCTGCGAAGAGGACTTCAT Chr8:74008376..74008395 59.95 50
upstream ENSMUSE00000581920 Chr8:74008167..74008263 AGAGCATCATTCGCTTCTGG Chr8:74008237..74008256 60.5 50
upstream ENSMUSE00000581919 Chr8:74007347..74007466 GTGTTTCCAGTTCACGAGCA Chr8:74007409..74007428 59.88 50
upstream ENSMUSE00000346919 Chr8:74007139..74007266 GGCTTCTACACATCGGCAAT Chr8:74007194..74007213 60.1 50
upstream ENSMUSE00000221609 Chr8:74006879..74007040 TGTGGTCTTCGCTCTCTTCA Chr8:74007001..74007020 59.7 50
upstream ENSMUSE00000221603 Chr8:74006406..74006558 GAAGCGATTGCTTTTCCAAC Chr8:74006483..74006502 59.83 45
upstream ENSMUSE00000221599 Chr8:74006183..74006309 TTCTTGCCCAAGGTTATGCT Chr8:74006248..74006267 59.71 45
upstream ENSMUSE00000221595 Chr8:74006032..74006087 CGGCTAGAGAGCACCTACGA Chr8:74006060..74006079 60.69 60
upstream ENSMUSE00000221591 Chr8:74005851..74005925 GACATGGACCGCCTAAAAGA Chr8:74005852..74005871 60.07 50
upstream ENSMUSE00000581918 Chr8:74004335..74005141 GACCGAGATACGGAGACTGG Chr8:74004459..74004478 59.68 60
upstream ENSMUSE00000402343 Chr8:74003050..74003241 CCCTCGTCAACAACCTGATT Chr8:74003134..74003153 59.97 50
upstream ENSMUSE00000331180 Chr8:74002826..74002957 No primer for this exon
upstream ENSMUSE00000434352 Chr8:74002620..74002730 GCTGGGTAGCTGAGGAGATG Chr8:74002656..74002675 59.97 60
upstream ENSMUSE00000581917 Chr8:74000284..74000820 GATCATCCCGTTGCAGACTC Chr8:74000550..74000569 60.63 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000034863