Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33535
Trapped Gene
OTTMUSG00000007639 (ENSMUSG00000053263)
Vector Insertion
Chr 11: 3205428 - 3231182
Public Clones IST12253B6 (tigm) IST13857B9 (tigm) IST12253B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416917 (Chr11:3230917..3231181 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGAAGCATGTTGCTGAGA Chr11:3230967..3230986 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416917 (Chr11:3230917..3231181 -)
Downstram Exon
ENSMUSE00000416906 (Chr11:3205429..3208117 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGAAGCATGTTGCTGAGA Chr11:3230967..3230986 60.14 50 ACCTGAAGACGCCAGAGAAA Chr11:3207701..3207720 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416917 Chr11:3230917..3231181 CCAGAAGCATGTTGCTGAGA Chr11:3230967..3230986 60.14 50
upstream ENSMUSE00000416906 Chr11:3205429..3208117 ACGGCAACCAACGCTTATAC Chr11:3207172..3207191 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGACATGGAAGCCCATAC Chr11:3228187..3228207 59.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr11:3228115..3228135 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053263