Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33538
Trapped Gene
Tmem149 (ENSMUSG00000036826)
Vector Insertion
Chr 7: 31351956 - 31352161
Public Clones IST14466G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000417007 (Chr7:31351768..31351955 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAGTTCACGGAAAACTGC Chr7:31351771..31351790 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000417007 (Chr7:31351768..31351955 +)
Downstram Exon
ENSMUSE00000534292 (Chr7:31352162..31352519 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAGTTCACGGAAAACTGC Chr7:31351771..31351790 60.3 50 GGCAGGGCCAGTAATGTAGA Chr7:31352453..31352472 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414188 Chr7:31348369..31348418 GCTTCGATATTCGGGACTGA Chr7:31348390..31348409 60.18 50
upstream ENSMUSE00000675815 Chr7:31348551..31348638 TCCCGACTTCACAACAAACC Chr7:31348606..31348625 60.93 50
upstream ENSMUSE00000675814 Chr7:31348949..31349015 CTTGTACCGGAATCCACAGAA Chr7:31348966..31348986 59.98 47.62
upstream ENSMUSE00000675813 Chr7:31349101..31349150 ACGTGGAGGTGCAAGAACAC Chr7:31349113..31349132 61.18 55
upstream ENSMUSE00000675812 Chr7:31349222..31349413 TCCCAACCTGAGGACTATCG Chr7:31349390..31349409 60.06 55
upstream ENSMUSE00000675811 Chr7:31349493..31349626 GACTTCCGAGAGTCCTGCTG Chr7:31349589..31349608 60.13 60
upstream ENSMUSE00000675810 Chr7:31349722..31349817 GAGGTGGCTTCTGCAACTTT Chr7:31349733..31349752 59.48 50
upstream ENSMUSE00000675809 Chr7:31350114..31351400 AGGGTGTAAGCCAACCACAG Chr7:31350419..31350438 60.03 55
upstream ENSMUSE00000675807 Chr7:31350446..31350485 No primer for this exon
upstream ENSMUSE00000243919 Chr7:31351183..31351400 CGTCAATGGAAGCCTCTAGC Chr7:31351296..31351315 59.98 55
upstream ENSMUSE00000417007 Chr7:31351768..31351955 ACGAGTTCACGGAAAACTGC Chr7:31351771..31351790 60.3 50

*** Putative Vector Insertion (Chr 7: 31351956 - 31352161) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000534292 Chr7:31352162..31352519 GGCAGGGCCAGTAATGTAGA Chr7:31352453..31352472 60.1 55
downstream ENSMUSE00000509023 Chr7:31352600..31352980 GAGCCAAATATGTGCCGAAT Chr7:31352881..31352900 59.93 45
downstream ENSMUSE00000675808 Chr7:31352600..31352977 GAGCCAAATATGTGCCGAAT Chr7:31352881..31352900 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTGCTAGACTCCTGGGGTA Chr7:31351955..31351976 60.14 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGCTAGACTCCTGGGGTA Chr7:31351955..31351976 60.14 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036826