Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33542
Trapped Gene
St7 (ENSMUSG00000029534)
Vector Insertion
Chr 6: 17784777 - 17794908
Public Clones IST12256A11 (tigm) IST12440H12 (tigm) IST12256H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656404 (Chr6:17784617..17784776 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCTCCGTAAGCCACTTGC Chr6:17784667..17784686 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656404 (Chr6:17784617..17784776 +)
Downstram Exon
ENSMUSE00000656403 (Chr6:17794909..17794963 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCTCCGTAAGCCACTTGC Chr6:17784667..17784686 59.5 55 ATATTCCGCACCCCTAAACA Chr6:17794961..17794980 59.3 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702799 Chr6:17643947..17644362 TGAGGATCAACGACAACCTG Chr6:17644336..17644355 59.68 50
upstream ENSMUSE00000702795 Chr6:17643994..17644362 TGAGGATCAACGACAACCTG Chr6:17644336..17644355 59.68 50
upstream ENSMUSE00000376393 Chr6:17644032..17644362 TGAGGATCAACGACAACCTG Chr6:17644336..17644355 59.68 50
upstream ENSMUSE00000702792 Chr6:17644167..17644362 TGAGGATCAACGACAACCTG Chr6:17644336..17644355 59.68 50
upstream ENSMUSE00000656390 Chr6:17644212..17644362 TGAGGATCAACGACAACCTG Chr6:17644336..17644355 59.68 50
upstream ENSMUSE00000508438 Chr6:17693592..17693694 GAGAAATGCCCAGTTTCCTG Chr6:17693648..17693667 59.67 50
upstream ENSMUSE00000359726 Chr6:17699226..17699614 GTAGCCGGCTCATCTCTTTG Chr6:17699475..17699494 59.98 55
upstream ENSMUSE00000656408 Chr6:17769250..17769332 AAAGTTCTACGTGGCCCTGA Chr6:17769278..17769297 59.73 50
upstream ENSMUSE00000656404 Chr6:17784617..17784776 AGTCTCCGTAAGCCACTTGC Chr6:17784667..17784686 59.5 55

*** Putative Vector Insertion (Chr 6: 17784777 - 17794908) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656403 Chr6:17794909..17794963 ATATTCCGCACCCCTAAACA Chr6:17794961..17794980 59.3 45
downstream ENSMUSE00000656402 Chr6:17796199..17796314 GTCAGAGGCTCTCGTCCTGT Chr6:17796234..17796253 59.58 60
downstream ENSMUSE00000656401 Chr6:17798004..17798079 GGCTTGAGGGTTCCTTTCTC Chr6:17798044..17798063 60.19 55
downstream ENSMUSE00000656400 Chr6:17800357..17800425 TCCCAGATGGTAGAGGAAGC Chr6:17800410..17800429 59.24 55
downstream ENSMUSE00000656399 Chr6:17802258..17802412 GGGACCCATGATGTTGTAGC Chr6:17802397..17802416 60.2 55
downstream ENSMUSE00000656398 Chr6:17804931..17805028 TCTGGTCCTTCCAAGTCTCC Chr6:17805007..17805026 59.23 55
downstream ENSMUSE00000656397 Chr6:17836004..17836118 TTAGGAGGGGAAACTCCTTCA Chr6:17836030..17836050 60.05 47.62
downstream ENSMUSE00000656396 Chr6:17854897..17854969 ATTGTCGCCGACTTTGGTAA Chr6:17854927..17854946 60.5 45
downstream ENSMUSE00000656395 Chr6:17856408..17856510 TTTGGCACGTGTGGATTAAA Chr6:17856512..17856531 59.97 40
downstream ENSMUSE00000656394 Chr6:17871989..17872139 TTCCCACGTACAATGCAAGA Chr6:17872138..17872157 60.11 45
downstream ENSMUSE00000702793 Chr6:17871989..17872124 AGAGATTCAAAGCCCCTTCC Chr6:17872121..17872140 59.65 50
downstream ENSMUSE00000656393 Chr6:17880766..17880858 GTCCCTTCTCCAGGGGATAC Chr6:17880804..17880823 59.76 60
downstream ENSMUSE00000656392 Chr6:17884119..17884258 TTCCGGAAACTGATGTGTCA Chr6:17884237..17884256 60.09 45
downstream ENSMUSE00000565143 Chr6:17892670..17893020 CATGAGAGGTTGGCACAGAA Chr6:17892830..17892849 59.83 50
downstream ENSMUSE00000656391 Chr6:17892670..17892966 CATGAGAGGTTGGCACAGAA Chr6:17892830..17892849 59.83 50
downstream ENSMUSE00000702789 Chr6:17892670..17892937 CATGAGAGGTTGGCACAGAA Chr6:17892830..17892849 59.83 50
downstream ENSMUSE00000702791 Chr6:17892670..17892966 CATGAGAGGTTGGCACAGAA Chr6:17892830..17892849 59.83 50
downstream ENSMUSE00000702798 Chr6:17892670..17893022 CATGAGAGGTTGGCACAGAA Chr6:17892830..17892849 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACCTCACAGTGGTTTGTG Chr6:17787805..17787825 60.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACCTCACAGTGGTTTGTG Chr6:17787805..17787825 60.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029534