Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33546
Trapped Gene
Dhx40 (ENSMUSG00000018425)
Vector Insertion
Chr 11: 86587305 - 86589271
Public Clones IST12527B7 (tigm) IST12528E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710375 (Chr11:86589162..86589270 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710375 (Chr11:86589162..86589270 -)
Downstram Exon
ENSMUSE00000675117 (Chr11:86587306..86587400 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709079 Chr11:86620940..86621108 No primer for this exon
upstream ENSMUSE00000709960 Chr11:86620940..86621108 No primer for this exon
upstream ENSMUSE00000361827 Chr11:86619962..86620129 No primer for this exon
upstream ENSMUSE00000586488 Chr11:86619962..86620129 No primer for this exon
upstream ENSMUSE00000404104 Chr11:86617759..86617904 No primer for this exon
upstream ENSMUSE00000586480 Chr11:86617759..86617904 No primer for this exon
upstream ENSMUSE00000269569 Chr11:86614471..86614590 No primer for this exon
upstream ENSMUSE00000577860 Chr11:86613075..86613149 No primer for this exon
upstream ENSMUSE00000269563 Chr11:86612922..86613149 No primer for this exon
upstream ENSMUSE00000269556 Chr11:86612424..86612490 No primer for this exon
upstream ENSMUSE00000269547 Chr11:86611125..86611256 No primer for this exon
upstream ENSMUSE00000497739 Chr11:86606664..86606763 No primer for this exon
upstream ENSMUSE00000494731 Chr11:86602988..86603074 No primer for this exon
upstream ENSMUSE00000105484 Chr11:86602669..86602851 No primer for this exon
upstream ENSMUSE00000105481 Chr11:86599259..86599339 No primer for this exon
upstream ENSMUSE00000105483 Chr11:86598381..86598538 No primer for this exon
upstream ENSMUSE00000105479 Chr11:86590117..86590231 No primer for this exon
upstream ENSMUSE00000710375 Chr11:86589162..86589270 No primer for this exon
upstream ENSMUSE00000716470 Chr11:86589162..86589270 No primer for this exon
upstream ENSMUSE00000105476 Chr11:86587306..86587400 No primer for this exon
upstream ENSMUSE00000675117 Chr11:86587306..86587400 No primer for this exon

*** Putative Vector Insertion (Chr 11: 86587305 - 86589271) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105480 Chr11:86585396..86585465 No primer for this exon
downstream ENSMUSE00000675114 Chr11:86585396..86585465 No primer for this exon
downstream ENSMUSE00000389367 Chr11:86584532..86584760 No primer for this exon
downstream ENSMUSE00000675113 Chr11:86584532..86584760 No primer for this exon
downstream ENSMUSE00000515896 Chr11:86583256..86583763 No primer for this exon
downstream ENSMUSE00000577861 Chr11:86583256..86583763 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTCACTGGCGGTGCTAAT Chr11:86589216..86589236 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGACAGCAGTGTTTTTGTGT Chr11:86589274..86589297 59.87 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018425