Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33550
Trapped Gene
Bbs9 (ENSMUSG00000035919)
Vector Insertion
Chr 9: 22452479 - 22459668
Public Clones IST11516D7 (tigm) IST12934E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702380 (Chr9:22452464..22452478 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702380 (Chr9:22452464..22452478 +)
Downstram Exon
ENSMUSE00000362779 (Chr9:22459669..22459809 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGGACAACCCGAGGAATAC Chr9:22459691..22459710 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422462 Chr9:22280189..22280499 TTGGGAACGTGGAAAACTTC Chr9:22280459..22280478 59.95 45
upstream ENSMUSE00000422449 Chr9:22295262..22295384 CCCGTGACTGGTGGTCTACT Chr9:22295289..22295308 60.03 60
upstream ENSMUSE00000422429 Chr9:22301153..22301303 TGGAAGTCGGGAAGTTTGTC Chr9:22301282..22301301 60.09 50
upstream ENSMUSE00000422423 Chr9:22308489..22308553 TCCCGGAAGCTCTGTGTCTA Chr9:22308523..22308542 60.93 55
upstream ENSMUSE00000333776 Chr9:22318424..22318537 TGACGTATGGACCCTTTGGT Chr9:22318508..22318527 60.23 50
upstream ENSMUSE00000392637 Chr9:22372149..22372323 TGATGGTGTTTGAGCAGGAA Chr9:22372188..22372207 60.24 45
upstream ENSMUSE00000281096 Chr9:22379555..22379639 GCCACAGATGCAGACAAGAA Chr9:22379574..22379593 59.99 50
upstream ENSMUSE00000281078 Chr9:22383081..22383264 CTGAATATTGGCGAGCAAGC Chr9:22383093..22383112 60.88 50
upstream ENSMUSE00000281061 Chr9:22383908..22384037 GCCGTCAGAGTAGGCTGTTT Chr9:22384015..22384034 59.5 55
upstream ENSMUSE00000280973 Chr9:22433386..22433564 TCACCTGCAGTGCTCGTATC Chr9:22433425..22433444 60.02 55
upstream ENSMUSE00000280946 Chr9:22440055..22440131 GTTTGGCCCTTGACTGAACA Chr9:22440057..22440076 61.08 50
upstream ENSMUSE00000280929 Chr9:22443174..22443227 GACTCTGTCCCGTCCATCAC Chr9:22443201..22443220 60.54 60
upstream ENSMUSE00000280891 Chr9:22448189..22448291 TGGTGTTGCAGAAGGTCAAG Chr9:22448208..22448227 59.87 50
upstream ENSMUSE00000362135 Chr9:22450408..22450512 No primer for this exon
upstream ENSMUSE00000702380 Chr9:22452464..22452478 No primer for this exon

*** Putative Vector Insertion (Chr 9: 22452479 - 22459668) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362779 Chr9:22459669..22459809 TTGGACAACCCGAGGAATAC Chr9:22459691..22459710 59.79 50
downstream ENSMUSE00000379729 Chr9:22463494..22463589 TAGGAGACGGAAGCCCATTA Chr9:22463552..22463571 59.66 50
downstream ENSMUSE00000341359 Chr9:22475229..22475401 CGGAGGATGAGTTCATTGGT Chr9:22475298..22475317 59.93 50
downstream ENSMUSE00000377404 Chr9:22483356..22483508 CTGAATGGCCCGAAATTGTA Chr9:22483427..22483446 60.83 45
downstream ENSMUSE00000280795 Chr9:22598195..22598377 AAATGGGTGGCACTCTTCAG Chr9:22598280..22598299 60.11 50
downstream ENSMUSE00000280764 Chr9:22616765..22616987 TCTTCGACAGGCAGGTTTTC Chr9:22616828..22616847 60.38 50
downstream ENSMUSE00000280735 Chr9:22692025..22692132 TGAGGTGCTTGTGGTTGGTA Chr9:22692114..22692133 60.15 50
downstream ENSMUSE00000354999 Chr9:22692306..22692718 AGGCAGCAACCATTTTCTTG Chr9:22692560..22692579 60.25 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGACTGGGGTGTTACACAG Chr9:22455451..22455471 59.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGACTGGGGTGTTACACAG Chr9:22455451..22455471 59.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035919