Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33565
Trapped Gene
Cog8 (ENSMUSG00000031916)
Vector Insertion
Chr 8: 109572608 - 109574211
Public Clones IST10901D4 (tigm) IST14132G3 (tigm) IST13983A4 (tigm) IST10719F2 (tigm)
IST14846A2 (tigm) IST11568E5 (tigm) IST14817A4 (tigm) IST15077H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000364072 (Chr8:109574042..109574210 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTCTGGCATTCCATCGAG Chr8:109574180..109574199 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000364072 (Chr8:109574042..109574210 -)
Downstram Exon
ENSMUSE00000580190 (Chr8:109572609..109573030 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTCTGGCATTCCATCGAG Chr8:109574180..109574199 60.04 45 GTCCAAGGTTTCCGTGCTTA Chr8:109572967..109572986 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346388 Chr8:109580161..109580584 CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50
upstream ENSMUSE00000611318 Chr8:109580161..109580583 CGCCAACTACAAGACGTTCA Chr8:109580267..109580286 59.9 50
upstream ENSMUSE00000214631 Chr8:109577922..109578129 TGACTCTAAACCGGCACACA Chr8:109578057..109578076 60.3 50
upstream ENSMUSE00000214632 Chr8:109576113..109576940 GCTAAGCCAGCTGATCCAAC Chr8:109576883..109576902 59.99 55
upstream ENSMUSE00000364072 Chr8:109574042..109574210 AATTCTGGCATTCCATCGAG Chr8:109574180..109574199 60.04 45
upstream ENSMUSE00000414609 Chr8:109572683..109573030 TAAGCACGGAAACCTTGGAC Chr8:109572989..109573008 60.11 50
upstream ENSMUSE00000580190 Chr8:109572609..109573030 TAAGCACGGAAACCTTGGAC Chr8:109572989..109573008 60.11 50

*** Putative Vector Insertion (Chr 8: 109572608 - 109574211) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335882 Chr8:109570195..109571171 ATGATTCGAGCTGTCCAACC Chr8:109571089..109571108 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTCTGTGGTTGATTTTG Chr8:109574223..109574243 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTCTGTGGTTGATTTTG Chr8:109574223..109574243 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031916