Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3358
Trapped Gene
Atp5sl (ENSMUSG00000057229)
Vector Insertion
Chr 7: 26404480 - 26405468
Public Clones XT0620 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520588 (Chr7:26404453..26404479 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520588 (Chr7:26404453..26404479 +)
Downstram Exon
ENSMUSE00000705921 (Chr7:26405469..26405483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520588 Chr7:26404453..26404479 No primer for this exon

*** Putative Vector Insertion (Chr 7: 26404480 - 26405468) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000705921 Chr7:26405469..26405483 No primer for this exon
downstream ENSMUSE00000520057 Chr7:26405915..26406111 AGGAACTGCAACAGCGTTCT Chr7:26406033..26406052 60.06 50
downstream ENSMUSE00000491024 Chr7:26407363..26407443 TACGGGCCATATTTCTCCTG Chr7:26407401..26407420 59.92 50
downstream ENSMUSE00000496317 Chr7:26408818..26408957 CGAGGAAATGGCTACGGTTA Chr7:26408873..26408892 60.09 50
downstream ENSMUSE00000353757 Chr7:26409046..26409208 CAATAGGTAGAGGCGGCTGA Chr7:26409131..26409150 60.37 55
downstream ENSMUSE00000514793 Chr7:26409734..26410569 CTCCCACATTTGAAGGTGCT Chr7:26410274..26410293 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTACGTTACCTGGCAAGATGG Chr7:26404446..26404467 60 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACGTTACCTGGCAAGATGG Chr7:26404446..26404467 60 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057229