Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33580
Trapped Gene
Dapk1 (ENSMUSG00000021559)
Vector Insertion
Chr 13: 60703958 - 60797591
Public Clones (sanger) (ggtc) (cmhd) IST14871E8 (tigm) IST10491E8 (tigm) IST10458C12 (tigm)
IST14456G3 (tigm) IST14383C11 (tigm) IST11191H11 (tigm) IST13430B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000478859 (Chr13:60703786..60703957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000478859 (Chr13:60703786..60703957 +)
Downstram Exon
ENSMUSE00000570720 (Chr13:60797592..60797813 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641588 Chr13:60703308..60703471 No primer for this exon
upstream ENSMUSE00000681690 Chr13:60703572..60703620 No primer for this exon
upstream ENSMUSE00000478859 Chr13:60703786..60703957 No primer for this exon

*** Putative Vector Insertion (Chr 13: 60703958 - 60797591) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570720 Chr13:60797592..60797813 No primer for this exon
downstream ENSMUSE00000385321 Chr13:60818039..60818177 No primer for this exon
downstream ENSMUSE00000118976 Chr13:60819375..60819504 No primer for this exon
downstream ENSMUSE00000403206 Chr13:60819663..60819711 No primer for this exon
downstream ENSMUSE00000352254 Chr13:60819798..60819824 No primer for this exon
downstream ENSMUSE00000395383 Chr13:60820971..60821123 No primer for this exon
downstream ENSMUSE00000365376 Chr13:60821472..60821517 No primer for this exon
downstream ENSMUSE00000326791 Chr13:60823135..60823224 No primer for this exon
downstream ENSMUSE00000326779 Chr13:60824381..60824473 No primer for this exon
downstream ENSMUSE00000326770 Chr13:60826658..60826777 No primer for this exon
downstream ENSMUSE00000326759 Chr13:60827177..60827275 No primer for this exon
downstream ENSMUSE00000339694 Chr13:60827923..60828021 No primer for this exon
downstream ENSMUSE00000326737 Chr13:60829789..60829887 No primer for this exon
downstream ENSMUSE00000326727 Chr13:60830738..60830935 No primer for this exon
downstream ENSMUSE00000326717 Chr13:60832186..60832383 No primer for this exon
downstream ENSMUSE00000326706 Chr13:60837605..60837703 No primer for this exon
downstream ENSMUSE00000326699 Chr13:60841416..60841493 No primer for this exon
downstream ENSMUSE00000326693 Chr13:60849462..60849684 No primer for this exon
downstream ENSMUSE00000326681 Chr13:60850554..60850742 No primer for this exon
downstream ENSMUSE00000326673 Chr13:60852492..60852689 No primer for this exon
downstream ENSMUSE00000326665 Chr13:60853575..60853713 No primer for this exon
downstream ENSMUSE00000326654 Chr13:60855470..60855590 No primer for this exon
downstream ENSMUSE00000326646 Chr13:60858710..60858898 No primer for this exon
downstream ENSMUSE00000326639 Chr13:60861996..60864546 No primer for this exon
downstream ENSMUSE00000500572 Chr13:60861996..60863245 No primer for this exon
downstream ENSMUSE00000570718 Chr13:60863718..60864546 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTACCAGGAAGGGGTGAC Chr13:60718957..60718977 60.23 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTACCAGGAAGGGGTGAC Chr13:60718957..60718977 60.23 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021559