Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33587
Trapped Gene
Cabp4 (ENSMUSG00000024842)
Vector Insertion
Chr 19: 4138773 - 4139610
Public Clones IST14757D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000244492 (Chr19:4139203..4139609 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACTCCAGGGAGCTACATC Chr19:4139579..4139598 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000244492 (Chr19:4139203..4139609 -)
Downstram Exon
ENSMUSE00000145468 (Chr19:4138774..4138804 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACTCCAGGGAGCTACATC Chr19:4139579..4139598 59.83 60 AACTCCTCAGGGCCCAGTTC Chr19:4138757..4138776 62.85 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000244492 Chr19:4139203..4139609 GCACTCCAGGGAGCTACATC Chr19:4139579..4139598 59.83 60
upstream ENSMUSE00000145468 Chr19:4138774..4138804 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4138773 - 4139610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145460 Chr19:4138549..4138692 ATGTAGCCGTCCTGGTCAGT Chr19:4138622..4138641 59.6 55
downstream ENSMUSE00000434684 Chr19:4137107..4137216 GGGCTTATCAGCTCCACAAA Chr19:4137149..4137168 60.21 50
downstream ENSMUSE00000244392 Chr19:4136114..4136261 CCATTTCTCGCAACATCTCA Chr19:4136125..4136144 59.8 45
downstream ENSMUSE00000390567 Chr19:4135425..4136015 GCCAGTAGGTTGTCCCTGAA Chr19:4135939..4135958 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTCCAGGGAGCTACATCAC Chr19:4139575..4139596 59.74 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTCCAGGGAGCTACATCAC Chr19:4139575..4139596 59.74 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024842