Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33600
Trapped Gene
Ankrd55 (ENSMUSG00000049985)
Vector Insertion
Chr 13: 113139071 - 113146113
Public Clones IST12240D6 (tigm) IST12240D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000394638 (Chr13:113138942..113139070 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCAAATGCTGTTGAAGA Chr13:113138989..113139008 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000394638 (Chr13:113138942..113139070 +)
Downstram Exon
ENSMUSE00000366734 (Chr13:113146114..113146298 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCAAATGCTGTTGAAGA Chr13:113138989..113139008 59.69 45 AGGTTACACTCGGGGACCTT Chr13:113146277..113146296 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610256 Chr13:113079028..113079190 GCTGAAGCTGACTGACGTTG Chr13:113079040..113079059 59.78 55
upstream ENSMUSE00000339009 Chr13:113108633..113108755 AAGAAGTCGACCTGGCAATG Chr13:113108645..113108664 60.26 50
upstream ENSMUSE00000376526 Chr13:113113260..113113390 CACACAGGATGCGTATGGTC Chr13:113113342..113113361 59.99 55
upstream ENSMUSE00000347186 Chr13:113117337..113117446 CAGATAAAAATGGCCGCCTA Chr13:113117392..113117411 60.05 45
upstream ENSMUSE00000402703 Chr13:113126423..113126483 TCCAGCCTCAGTGAGATCAA Chr13:113126448..113126467 59.5 50
upstream ENSMUSE00000568871 Chr13:113134251..113134436 TTCCGTGGTCCAACTAAACC Chr13:113134269..113134288 59.83 50
upstream ENSMUSE00000394638 Chr13:113138942..113139070 CACCCAAATGCTGTTGAAGA Chr13:113138989..113139008 59.69 45

*** Putative Vector Insertion (Chr 13: 113139071 - 113146113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366734 Chr13:113146114..113146298 AGGTTACACTCGGGGACCTT Chr13:113146277..113146296 59.86 55
downstream ENSMUSE00000440533 Chr13:113153623..113153790 GTCCCTTAGGTTGCTGTCCA Chr13:113153713..113153732 60.11 55
downstream ENSMUSE00000401009 Chr13:113157892..113158556 TCCTGTTCGCTTCGACTTTT Chr13:113158362..113158381 59.99 45
downstream ENSMUSE00000120518 Chr13:113171337..113171429 GTTTGGGGAGAGATGCTGAA Chr13:113171368..113171387 60.19 50
downstream ENSMUSE00000120519 Chr13:113173627..113174210 TTTTCATCATGGGTGGGACT Chr13:113173786..113173805 60.17 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGGGCAGTCCAGGTAAGA Chr13:113139058..113139078 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGGGCAGTCCAGGTAAGA Chr13:113139058..113139078 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049985