Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33607
Trapped Gene
St8sia6 (ENSMUSG00000003418)
Vector Insertion
Chr 2: 13576566 - 13587140
Public Clones (sanger) IST13883E12 (tigm) IST12995F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000420833 (Chr2:13587047..13587139 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000420833 (Chr2:13587047..13587139 -)
Downstram Exon
ENSMUSE00000270283 (Chr2:13576567..13578917 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647487 Chr2:13714971..13715689 No primer for this exon
upstream ENSMUSE00000387575 Chr2:13714381..13714479 No primer for this exon
upstream ENSMUSE00000421340 Chr2:13645070..13645159 No primer for this exon
upstream ENSMUSE00000420853 Chr2:13618455..13618541 No primer for this exon
upstream ENSMUSE00000342151 Chr2:13594110..13594254 No primer for this exon
upstream ENSMUSE00000352003 Chr2:13590412..13590524 No primer for this exon
upstream ENSMUSE00000420833 Chr2:13587047..13587139 No primer for this exon
upstream ENSMUSE00000270283 Chr2:13576567..13578917 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTGAGCCAGGGTCTCTCA Chr2:13578160..13578180 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGATAGCCATTCCCACCT Chr2:13578119..13578139 59.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003418